The Tunable Transmission of the Aromatic Character of the Aglycone Through the Anomeric Effect in C-nucleosides Drives its Own Sugar Conformation: A Thermodynamic Study
I. Luyten, C. Thibaudeau, A. Sandström and J. Chattopadhyaya*
Department of Bioorganic Chemistry,
Box 581, Biomedical Centre,
University of Uppsala,
S-751 23 Uppsala, Sweden
* Fax: +4618554495; E-mail: jyoti@bioorgchem.uu.se.
The anomeric and the gauche effects are two competing stereoelectronic forces that drive the two-state North (N) (C2'-exo-C3'-endo) South (S) (C2'-endo-C3'-exo) pseudorotational equilibrium in nucleosides. The quantitation of the energetics of pD dependent N - S pseudorotational equilibria of the pentofuranose moiety in C-nucleosides 1 - 7 shows that the strength of the anomeric effect of the constituent heterocyclic moiety at C1' is dependent upon the unique aromatic nature of the nucleobase, which is tuned by the pD of the medium. The force that drives the protonation deprotonation equilibrium of the heterocyclic nucleobases in C-nucleosides is transmitted through the anomeric effect to drive the N - S pseudorotational equilibrium of the constituent furanose, which is supported by the following observations: (i) The enhanced strength (DDG298(P-N) ) of the anomeric effect in the protonated (P) nucleoside compared to the neutral (N) form is experimentally evidenced by the increased preference of N-type sugar conformation with pseudoaxial nucleobase by 2.0 kJ/mol for formycin B (1), 1.4 kJ/mol for formycin A (2), 1.4 kJ/mol for 9-deazaadenosine (3) and 1.9 kJ/mol for Y-isocytidine (4). (ii) In contrast, the S-type sugar conformer, which places the nucleobase in pseudoequatorial orientation, is considerably more preferred in the alkaline medium owing to the weakening of the anomeric effect in the N1 deprotonated (D) formycin B, and N3-deprotonated Y-isocytidine, Y-uridine and 1-methyl-Y-uridine compared to the neutral counterparts by DDG°(N-D) of 0.2 kJ/mol for formycin B (1), 1.6 kJ/mol for Y-isocytidine (4), 1.7 kJ/mol for Y-uridine (5), 0.8 kJ/mol for 1-methyl-Y-uridine (6). (iii) The quantitation of the pD-dependent drive of N - S pseudorotational equilibria in C-nucleosides 1 - 6 has allowed us to independently measure the pKa of the constituent heterocyclic nucleobases. (iv) A simple comparison of DG 298 N or DG 298 P or DG 298 D values of all C-nucleosides 1 - 7 with N-nucleosides shows that the C1' substituent promoted anomeric drive of N - S equilibrium to N-sugar is weaker in C-nucleosides than in N-nucleosides, but their respective flexibilities from the neutral to the protonated or to the deprotonated state is completely aglycone-dependent.
What is the Nature of Hydration in the Minor Groove of DNA Duplex? An Investigation by Base-pair Exchange Kinetics and NMR Study
T. V. Maltseva, P. Roselt and J. Chattopadhyaya*
Department of Bioorganic Chemistry,
Box 581, Biomedical Center,
University of Uppsala,
S-751 23 Uppsala, Sweden.
* Fax: +4618554495; E-mail: jyoti@bioorgchem.uu.se.
(i) A combination of NOESY and ROESY experiments, using NH4Cl as a catalyst across the pH range of 5 to 8.6, has shown that the presence of bound-water in the minor groove of d5'(1C2C3A4T5T6A7A8T9G10G)23' is a result of straight dipole-dipole effect at physiological pH, whereas the relay effect becomes more dominant at pH > 8. The residence time of water near H2 of adenine (H2A) has been estimated to be in the range of 0.3 - 0.5ns from the straight dipole-dipole effect, which is quite low in order to be considered structurally important. This is in contradiction of the X-ray data on this duplex.
(ii) It has been shown that the relay effect takes place from the open-state of the duplex, and the pathway of the relay effect is from H2A to imino proton of T to water. It has been qualitatively estimated that the lower limit of the distance between H2A and imino proton of T is ~ 3Å in the open-state of the duplex. At this distance, the efficiency of the relay effect is dictated by the exchange process of the imino proton with water, which is in turn defined by the lifetime of the open-state as well as by the concentration of the catalyst.
(iii) The actual hydration pattern in the minor groove
of the ATTAAT tract has been found to be delicately balanced by the nucleotide
sequence around it, which has been clearly evidenced from a comparison of
a pair of duplexes with a single terminal basepair reversal.
Solution Structure of Tandem Oligonucleotide Duplex with two Spatially Adjacent Steroid Residues
A. Yu. Denisov(1), T. V. Maltseva(1), A. Sandstrom(1),
D. V. Pyshnyi(2), E. M. Ivanova(2), V. F. Zarytova2 and J. Chattopadhyaya1*
(1)Department of Bioorganic Chemistry,
University of Uppsala,
75123 Uppsala, Sweden
(2)Novosibirsk Institute of Bioorganic Chemistry of RAS,
630090 Novosibirsk, Russia
*Fax: +4618554495; E-mail: jyoti@bioorgchem.uu.se.
Covalent linking of steroids to oligonucleotide terminal phosphate group promote stabilization of complementary complexes (1, 2). For detailed understanding of this effect in stereochemical terms, the spatial structure of estrone (EsS) tethered d3'(pCAGCp-EsS)3' d5'(EsS-pTCCA3'): d5'(pTGGAGCTG)3' tandem duplex with two spatially adjacent estrone residues was investigated by NMR, and compared with the solution structure of the same duplex without steroids. The full assignment of all estrone and oligonucleotide proton signals in two-dimensional NMR spectra (NOESY, DQF-COSY, ROESY, HSQC, etc.) as well as fully relaxed NOESY matrix analysis and AMBER molecular dynamics refinements were used for this structure modeling.
It has been found that the general structure of both tandem duplexes corresponds to the B-type DNA. The aromatic protons of 3'-estrone residue have strong NOE-peaks with the sugar protons of cytidine bearing this 3'-steroid, and H2' of cytidine sugar ring is shifted to high field by 0.7 ppm due to the influence of 3'-estrone aromatic residue. The aromatics of the second 5'-estrone residue has strong NOE-peaks with aromatic and methyl group protons of the base of thymidine bearing this 5'-steroid.These typical NMR features suggested to us that both steroids are located into the major groove of DNA duplex. Also the methyl groups of both 3'- and 5'-estrones have NOE-contacts with the same H2 proton of adenosine base in octanucleotide that proves the spatial proximity of these estrone residues. The increase of thermal stability for such kind of tandem duplexes can be explained by hydrophobic interactions between two adjacent steroid residues.
References
1. R. L. Letsinger et al., J.Am.Chem.Soc.,
115, 7535 (1993).
2. D.V. Pyshnyi et al., Nucleic Acids Symposium Series, 31,
115 (1994).
The Discovery of Intramolecular
Stereoelectronic Forces That Drive the Sugar Conformation in Nucleosides
and Nucleotides
C. Thibaudeau & J. Chattopadhyaya*
Department of Bioorganic Chemistry,
Box 581, Biomedical Centre,
Uppsala University,
-751 23 Uppsala, Sweden
*Fax: +4618554495; E-mail: jyoti@bioorgchem.uu.se.
This report summarizes our work1 on the thermodynamics of the stereoelectronic forces that dictate the conformation of the sugar moiety in b-D/L- as well as in a-D/L- nucleos(t)ides: (1) The anomeric effect of the nucleobase drives the N - S equilibrium toward N-type sugars1a. The [O3'-C3'-C4'-O4'] and [O2'-C2'-C1'-Nbase] gauche effects push it toward S.1a The [C2'-C2'-C1'-O4'] gauche effect favours N-type sugars1a. The [O2-C2'-C3'-O3'] gauche effect operates both in N-type and S-type sugars and the [O5'-C5'-C4'-O4'] gauche effect is minimal1a. (2) The energetics of the gauche effects that drive the N - S equilibrium in the pentofuranose moiety are nucleobase-dependent1a,i. The strength of the anomeric effect in b-nucleosides is specifically dictated by the unique electronic character of the constituent aglycone1a,c. It can be modulated upon protonation and/or deprotonation of the constituent nucleobase as a result of the transfer of the protonation (N - S) deprotonation energy to drive the conformation of the sugar moiety (energy pump)1k. From our data on the sigmoidal dependence of the energetics of two-state N - S equilibrium upon the pD of the solution1k, we have independently reproduced the literature values of the pKa of nucleobases in b-nucleosides, which thereby confirms the validity of the two-state model. (3) The strengths of stereoelectronic forces that drive the N - S pseudorotational equilibrium depend on the anomeric configuration1n. The thermodynamics of the N - S equilibrium in the mirror image D- and L-2'-dNs in either a- or b-forms are identical within the timeframe and accuracy of NMR spectroscopy.1n (4) The extent of the preference for S-type sugars in a-D-2'-dNs at any pD is reduced owing to their inherent weaker anomeric effect compared to b-counterparts1n although the nucleobases in a- and b-D-2'-dNs have the identical electronic character. (5) The amplitudes of the nucleobase-dependent changes of the thermodynamics of the N - S equilibrium as a function of pD are different in a-D-2'-dNs and in b-D-2'-dNs and show the lack of flexibility of the former1n. (6) The phosphate backbone and pentofuranose conformation in ribonucleotides1d,j are interdependent because of the participation of the 2'-OH group to give a unique cooperative two-state (N,et) - (S,e-) conformational equilibrium.
References on the above work from our lab
(1) (a) J. Plavec; W. Tong and J. Chattopadhyaya J. Am. Chem. Soc., 115, 9734 (1993). (b) J. Plavec; N. Garg and J. Chattopadhyaya J. Chem.Soc., Chem. Commun., 1011 (1993). (c) J. Plavec; L. H. Koole and J. Chattopadhyaya J. Biochem. Biophys. Meth., 25, 253 (1992). (d) J. Plavec; C. Thibaudeau; G. Viswanadham; C. Sund and J. Chattopadhyaya J. Chem. Soc., Chem. Comm., 781 (1994). (e) C. Thibaudeau; J. Plavec; K.A. Watanabe and J. Chattopadhyaya J. Chem. Soc., Chem. Comm., 537 (1994). (f) C. Thibaudeau; J. Plavec; N. Garg; A. Papchikhin and J. Chattopadhyaya J. Am. Chem. Soc., 116, 4038 (1994). (g) J. Plavec; C. Thibaudeau and J. Chattopadhyaya J. Am. Chem. Soc., 116, 6558 (1994). (h) C. Thibaudeau; J. Plavec and J. Chattopadhyaya J. Am. Chem. Soc., 116, 8033 (1994). (i) J. Plavec Ph.D. Thesis, Department of Bioorganic Chemistry, Uppsala University, Sweden, 1995. (j) Plavec, J.; Thibaudeau, C; Chattopadhyaya, J. Tetrahedron, 51, 11775 (1995). (k) C. Thibaudeau; J. Plavec and J. Chattopadhyaya J. Org. Chem., 61, 266 (1996). (l) J. Chattopadhyaya, Nucl. Acids Symposium Series , 35, 111 (1996). (m) Plavec, J.; Thibaudeau, C. and Chattopadhyaya, J. in How do the Energetics of the Stereoelectronic Gauche and Anomeric Effects Modulate the Conformation of Nucleos(t)ides?, Pure and Applied Chemistry, 68, 2137 (1996). (n) C. Thibaudeau and J. Chattopadhyaya, J. Org. Chem., 1996, submitted. (o) C. Thibaudeau and J. Chattopadhyaya, Nucleosides Nucleotides, 1997, in press.
Strategies in DNA Sequence Recognition
Richard E. Dickerson, Gye-Won Han, Mary L. Kopka and
David S. Goodsell
Molecular Biology Institute,
University of California, Los Angeles
Los Angeles CA 90095
Early pictures of the recognition of DNA sequence by proteins involved the passive recognition of hydrogen bond donors and acceptors along the floor of the major and minor groove, primarily by amino acid side chains of the protein. One common pattern in early DNA/Protein structures was the helix-turn-helix motif, in which a recognition helix is held in a fixed orientation within the wide minor groove of the B-DNA duplex. Another more limited pattern involved insertion of protein strands or loops within the narrower minor groove. But the precise mode of recognition of DNA by protein remained (and remains) elusive, leading one of the primary participants to write a 1988 Nature News and Views column entitled, "ProteinDNA interaction: No code for recognition."
Nine years later, the hydrogen-bonding code remains uncertain, but to passive H-bonding has been added another important component: sequence-selective deformability (primarily bendability) of the DNA duplex. This was first encountered with CAP, but has since been seen in many other proteins. In CAP the bending protein sits on the concave side of the bend, inserting a-helices into two adjacent major grooves and metaphorically "pulling" the DNA into a curved conformation. With lac repressor and PurR the protein again inserts a-helices into two major grooves, but sits on the convex side of the bend, "pushing" the DNA out of linearity. The human TATA-binding protein or TBP opens up and flattens the minor groove of the TATATATA binding site completely, forcing a 100° kink in helix direction. In an even more extreme example, the integration host factor, IHF, produces a complete 180° reversal of chain direction by inserting antiparallel loops of protein chain into the minor groove. Outside the loop, the two helical extensions are kept rigidly straight by their base sequences.
Some of the factors involved in sequence-dependent bendability or non-bendability in DNA/Protein complexes will be discussed, using principles deduced from environmentally similar DNA/DNA associations within the crystal. Relevant new information is provided by the crystal structure of the B-DNA decamer: C-A-A-A-G-A-A-A-A-G.
A Molecular Dynamics Study of a DNA Oligomer Containing the TATA-box Binding Protein Target Sequence
Delphine Flatters, Matthew Young*, David L. Beveridge*
and Richard Lavery
Laboratoire de Biochimie Théorique,
UPR 9080 CNRS
Institut de Biologie Physico-Chimique
13, rue Pierre et Marie Curie,
Paris 75005, France
*Department of Chemistry and Molecular Biophysics Program,
Wesleyan University,
Middletown, CT 06459, USA
Recent encouraging results have been obtained from molecular dynamic (MD) simulations of DNA using the new AMBER force field [1] and applying the particle mesh Ewald (PME) summation method to avoid electrostatic truncation [2]. Several studies using these conditions for nanosecond length simulations show that the trajectories generated are stable and the results obtained indeed depend on the DNA base sequence.
We report here two such MD simulations for a DNA duplex with the sequence d(GCGTATATAAAACGC)2 including explicit consideration of roughly 4000 TIP3P water molecules and 28 Na+ counterions [4]. These simulations were carried out for roughly 1 ns starting from two different conformations: a canonical B-DNA conformation and a hybrid conformation where the sugars of the central sequence were forced into C3'-endo puckers. The sequence was chosen because it contains a target site for the TATA-binding protein (TBP), involved in transcription initiation and which strongly deforms DNA upon binding, as shown by crystallographic studies (local helix unwinding being coupled with an overall bend of roughly 90° toward the central major groove) [5,6].
For both our trajectories, the central tract of the sequence shows a preference for an A-like conformation. We observe apparent convergence to a structure showing a 4 Å rms difference with canonical DNA-A and a 6 Å rms difference with canonical DNA-B. The sequence also has a tendency to bend toward the major groove, as observed in the crystallographic complex with TBP (the angle between the terminal helical axis vectors reaching roughly 40° in the first simulation and 60° in the second simulation). Furthermore, a 2D rms difference map of the second simulation shows that the bending is associated with an oscillation having a period of rough 500 ps. These results suggest that the dynamical behavior of TBP target sequences may be important for understanding their binding properties.
References
[1] W.D. Cornell, P. Cieplak, C.I. Bayly, I.R. Gould, K.M.
Merz Jr., D.M. Ferguson, D.C. Spellmeyer, T. Fox, J.W. Caldwell and P.A.
Kollman J. Am. Chem. Soc., 117, 5179-5197 (1995).
[2] T.A. Darden, D.M. York and L.G. Pedersen J. Chem. Phys., 98,
10089-10092 (1993).
[3] T.E. Cheatham III and P.A. Kollman J. Mol. Biol., 259, 434-444
(1996).
[4] D. Flatters, M.A. Young, D.L. Beveridge and R. Lavery J. Biomol.
Struct. Dyn. (1997) submitted.
[5] Y. Kim, J.H. Gieger, S. Hahn and P.B. Sigler Nature 365, 512-520,
(1993).
[6] J.L. Kim and S.K. Burley Nature Struct. Biol., 1, 638-653 (1994).
Effects of 5-FU on the Structure, Stability and Dynamics of the U4-U6 snRNA Complex
William H. Gmeiner, Parag V. Sahasrabudhe, Junqu Sun
and Jinqian Liu
Eppley Institute and Department of Pharmaceutical Sciences,
University of Nebraska Medical Center,
Omaha, NE USA 68198-6805
5-Fluorouracil (5-FU) is an anticancer drug used clinically for the treatment of solid tumors, particularly colorectal cancer. 5-FU is activated in-vivo to FdUMP, a dUMP analogue that inhibits thymidylate synthase (TS), an enzyme required for dTMP synthesis and cell proliferation. While cell proliferation may be restored by addition of dT to medium containing concentrations of 5-FU that are otherwise growth-inhibitory, still higher concentrations of 5-FU inhibit cell proliferation despite the availability of dT. The mechanism, other than TS inhibition, by which 5-FU inhibits cell proliferation is believed to involve incorporation of the nucleotide analogues FdUTP and FUTP into DNA and RNA, respectively.
Figure 1: Secondary structure for the human U4-U6 snRNA complex.
Our laboratory has explored the effects of 5-FU substitution on the structure, stability, and dynamic motion of the U4-U6 snRNA complex in order to gain insight into how 5-FU substitution may interfere in critical RNA-mediated processes such as pre-mRNA splicing. The U4-U6 snRNA complex is essential for pre-mRNA splicing and contains two stem regions consisting of eight and 16 base pairs, respectively (Figure 1). Stem II consists of 16 base pairs which include a G-U wobble base pair and a C-U mismatched base pair. We have studied the stability of these duplex regions using UV hyperchromicity experiments and have determined that 5-FU slightly destabilizes the stem II duplex when substitution occurs at the G-U wobble base pair but stabilizes this RNA duplex when substitution occurs at the C-U mismatched base pair. NMR studies of the stem II duplex do not reveal any global change to the time-averaged, three dimensional structure for the stem II duplex as a result of 5-FU substitution. Rather, 5-FU causes an increased localized RMSD for the base pairs directly substituted with 5-FU. NMR studies measuring the exchange rates for imino hydrogens with H2O indicate that the imino hydrogen from A-FU, G-FU, and C-FU base pairs exchange more rapidly with H2O by a process that does not require base catalysis near physiological pH. Although exchange with solvent is more rapid for base pairs involving 5-FU, analysis of chemical shifts and NOEs for the base pairing partner of 5-FU demonstrates that an ionized base pair does not form in the interior of the duplex.
Figure 2: Model of the 5' stem-loop from U4 snRNA.
The effects of 5-FU substitution on the structure, stability and dynamics of the 5' stem-loop from human U4 snRNA were investigated using 1H and 19F NMR spectroscopy, PAGE analysis, and molecular modelling studies. A 3D model for this stemloop is shown in Figure 2. The secondary structure for the 16 nucleotide loop consists of four base pairs at the base of a non-canonical tetraloop (UUUA). The shorter stem-loop was joined to the nine base pair stem by two A residues on the 5' side and a single bulged A on the 3' side. Both stems also had bulged A residues. 5-FU substitution caused the stem-loop to migrate more slowly by PAGE suggesting the conformation of this stem-loop is sensitive to 5-FU substitution, perhaps as a consequence of disruption of base pairs in the upper stem loop.
Sequence-Specific Ligands That
use Parallel and Antiparallel Side-by-Side Peptide Motifs in Binding to
DNA
Anna N. Surovaya(1), Gunther Burckhardt(2), Sergei L.
Grokhovsky(1,3), Eckhard Birch-Hirschfeld(4), Georgii V. Gursky(1) and Christoph
Zimmer(2)
(1)Engelhardt Institute of Molecular Biology,
Russian Academy of Sciences, Moscow 117984, Russia
(2)Institute of Molecular Biology
(4)Institute of Virology,
Friedrich Schiller University,
Jena 07745, Germany
(3)University of Oslo,
Center for Medical Studies,
Oslo, Norway
Bis-netropsins are synthetic sequence-specific ligands composed of two netropsin-like fragments which can be linked in head-to-head, head-to-tail and tail-to-tail manners (1). Among these compounds, Pt-bis-netropsin (Pt-bis-Nt) is known to bind preferentially to DNA regions with a pseudosymmetrical sequence 5'-TXTTAAYA-3' , where X and Y are predominantly A or T (2).
CD studies and thermodynamic characterization of the DNA-binding properties exhibited by Pt-bis-Nt reveal that it forms two types of complexes with poly[d(AT)]poly[d(AT)] and DNA oligomers containing nucleotide sequences 5'-CC(TA)n CC-3', with n = 4, 5 and 6. The first type corresponds to the binding of Pt-bis-Nt in the extended conformation and is characterized by the saturating ratio of one bound Pt-bis-netropsin molecule per 9 AT-base pairs. The second type of the complex corresponds to the binding of Pt-bis-Nt to DNA in the folded hairpin form. The binding approaches saturation level when one Pt-bis-netropsin molecule is bound per four AT-base pairs. The hairpin-like form of Pt-bis-Nt complex is built on the basis of parallel side-by-side peptide motif which is inserted into the minor DNA groove. The CD spectral profiles reflecting the binding of Pt-bis-Nt in the hairpin form are different from those observed for binding of another bis-netropsin (Gly3-bis-Nt) with the sequence Lys-Gly-Py-Py-Gly-Gly-Gly-Py-Py-, where Py is a N-propylpyrrole amino acid residue and Dp is a dimethylaminopropylamino residue. The hairpin form of this bis-netropsin is formed on the basis of antiparallel side-by-side peptide motif. The CD spectra obtained for binding of Gly3-bis-Nt in the hairpin form to poly[d(AT)]poly[d(AT)] exhibit positive CD band with a peak at 325 nm, whereas the CD spectral profiles for the second complex of Pt-bis-Nt with poly[d(AT)]poly[d(AT)] and short DNA oligomers have two intense positive CD bands near 290 nm and 328 nm. This reflects the fact that two bis-netropsins use different structural motifs on binding to DNA in the hairpin form. In contrast, complexes of the first type are characterized by CD spectral profiles which are similar for two bis-netropsins, although sizes of their binding sites on poly[d(AT)]poly[d(AT)] are found to be equal to 7 and 9 AT-base pairs for interaction with Gly3-bis-Nt and Pt-bis-Nt, respectively. Each bis-netropsin binds only in the extended conformation to poly(dA)poly(dT). The CD spectral profiles observed for complexes of two hairpin polyamides with the 12-mer duplex 5'-CC(TA)4 CC-3' are shown below.
Illustrated are the general plans of the complex structures formed by Pt-bis-Nt (a) and Gly3-bis-Nt (b) with DNA in the hairpin forms. The hairpins are built on the basis of parallel and antiparallel side-by-side peptide motifs, respectively. Indicated are the directions from N-terminus to C-terminus in the pyrrolecarboxamide fragments of the bis-netropsin molecules. The CD spectra were recorded for mixtures of Pt-bis-Nt and 12-mer duplex (30 mM) (c) and for mixtures of Gly3-bis-Nt and 12-mer duplex (32.6 mM) (d). The ligand/DNA oligomer molar ratios were as follows: panel c, 0 (0), 1 (0.08), 2 (0.33), 3 (0.49), 4 (0.82), 5 (1.65), 6 (2.14); panel d, 0 (0), 1 (0.15), 2 (0.31), 3 (0.53), 4 (0.88), 5 (1.32), 6 (2.41), 7 (2.87). A new parallel side-by-side peptide motif can be used for the design of a new generation of sequence-specific DNA-binding ligands.
References
1. G. V. Gursky, A. S. Zasedatelev, A. L. Zhuze, A. A.
Khorlin, S. L. Grokhovsky, S. A. Streltsov, A. N. Surovaya, S. M. Nikitin,
A. S. Krylov, V. O. Retchinsky, M. V. Mikhailov, R. Sh. Beabealaschvilli
and B. P. Gottikh, Cold Spring Harbor Symp. Quant. Biol. 47, 367-378,
1983.
2. S. L. Grokhovsky and V. E. Zubarev, Nucleic Acids Res. 19, 257-264,
1990.
We greatfully acknowledge support for this work from the
Deutche Volkswagen Stiftung (grant AZ.I/70409) and from the Russian Foundation
for Basic Research.
p53-DNA Interactions: DNA Bending
and Flexibility
P. Balagurumoorthy, Ettore Appella* and Rodney E. Harrington
Department of Biochemistry,
University of Nevada Reno,
Reno, NV89557
*Laboratory of Cell Biology,
Building 37,
National Cancer Institute,
National Institutes of Health,
Bethesda, MD20892
The function of the tumor suppressor protein p53is closely related to its ability to bind its target DNA response elements. We have previously shown that the DNAbinding domain of human wild type p53 (p53DBD) binds the 20base pair p21/waf1/cip1 response element DNA as a tetramerand that the resulting nucleoprotein complex is bent (1). Inorder to gain further insight into the structural basis ofthis interaction, we have investigated the binding of p53DBDto a single pentameric quarter site, decameric half sitesand response elements containing half sites separated by aspacer DNA. We report that p53DBD does not bind isolatedquarter sites whereas cooperative dipeptide binding is observed for several half sites. The dipeptide-half site DNAcomplex is bent by ~ 27° to 30° as verified by T4 DNA ligase-mediated cyclization. When half sites are separatedwith spacer DNA, tetrapeptide binding occurs only when the spacer DNA is flexible and the entire response element DNAis bent. A comparison of different DNA response elements forp53 shows that a central d(CA)d(TG) DNA sequence element isa common attribute of at least one and frequently of bothhalf sites. Cyclization studies on the p21/waf1/cip1, RGCand mdm2 response elements suggest that intrincicflexibility at these d(CA)d(TG) sites may be a factor inthe observed DNA bending in the nucleoprotein complexes. These studies lead us to conclude that DNA bending in thep53-DNA complex, along with DNA-peptide and peptide-peptidecontacts, may be an important aspect of p53-response elementbinding stereospecificity. The biological implications ofsuch bent DNA-p53 complexes in the context of binding aswell as transactivation will also be discussed.
References
1. Balagurumoorthy, P., Sakamoto, H., Lewis, M. S., Zambrano, N., Clore, G. M., Gronenborn, A. M., Appella, E. and Harrington, R.E., Proc. Natl. Acad. Sci. USA 32, 8591-8595 (1995).
High Resolution Information on Specific Interactions Between the p53 DNA Binding Domain and DNA Response Elements
A. K. Nagaich(1), P. Balagurumoorthy(1), H. Sakamoto(2),
V. B. Zhurkin(3), G. M. Clore(4), A. M. Gronenborn(4), E. Appella(1) and
R. E. Harrington(1)
(1)Department of Biochemistry,
School of Medicine,
University of Nevada, Reno, NV 89557 USA
(2)Laboratory of Cell Biology and
(3)Laboratory of Mathematical Biology,
NCI, and (4)Laboratory of Chemical Physics, NIDDK,
National Institutes of Health,
Bethesda, MD 20892 USA.
The p53 protein is a pleiotropic transcriptional regulator that has beenidentified as a tumor suppressor of importance in the etiology of cancer. Wildtype p53 is a widely distributed phosphoprotein whose tumor suppressorfunction is expressed through a dominant negative phenotype and is anessential component of the G1 pathway of cell cycles that response to DNAdamage. It acts as a transcriptional enhancer for a number of DNA damageand growth arrest genes including mdm2, Gadd45 and Waf1/Cip1, the latterinvolved in the G1/S phase checkpoint. When expressed at high levels, p53suppresses transformation, arrests cells in G1 phase and in some casespromotes apoptosis. Studies of tumorigenic mutants have shown that theseare selectively located at sites that map directly to the specific DNA bindingdomain of p53. This fact, supported by recent biochemical and moleculargenetic evidence, has clearly demonstrated that much of the biologicalfunction of p53 is mediated by its DNA binding properties.
A recent cocrystal structure of a minimal core p53 DNA binding domainpeptide (p53DBD) complexed with a DNA response element has providedvaluable insights into the binding specificity of p53 by identifying specificbinding contacts (1). However, many important questions remainedunanswered by that study including the full complex size as well as theorganization of p53 tetramers bound to the subcomponents of the DNArecognition site, the stability and energetics of complex formation underphysiological or quasi-physiological conditions and the possible role ofallosteric conformational changes in the protein associated with DNA binding.
To further understand the binding behavior of p53 with its responseelements and the roles of certain point mutations in the binding of the wildtype p53DBD peptide (amino acids 98-309) to naturally occurring p53response elements, we have carried out an extensive biophysicalcharacterization including cyclization studies (2), binding affinity and stoichiometry assays using ultracentrifugation (2), and high resolutionchemical probes footprinting on the complex between wild type p53DBD andcertain tumorigenic single site mutants with the functionally important Waf1 response element. The first methods have demonstrated that the p53DBDpeptide binds the Waf1/Cip1 response element as a tetrapeptide and inducesDNA bending. The biochemical methods can footprint the peptides on the DNA and identify protein-DNA contacts at single nucleotide resolution. Additional chemical probes studies utilizing the p53 recognition sequenceused in the cocrystal structure (1) verify the protein-DNA contacts observed in the cocrystal, but also suggest additional ones that may be important in thefull complex.
The studies demonstrate tetrapeptide binding of p53DBD with the Waf1response element (2) and provide the first direct experimental evidence thatthe four subunits bind to the major groove on the same face of the response element DNA. The results show that the most energetically important contactsare located in the protein monomer that interacts with the highly conservedC(A/T)|(T/A)G part of consensus p53 half sites. In particular, the invariant guanosine nucleotides of each consensus pentameric site make highlyimportant contacts with the protein. Molecular modelling studies based uponthe findings also suggest specific interpeptide interactions that may requirethe response element DNA to bend in the association complex as reportedearlier (2). Finally, DNA cyclization studies on response element DNAcombined with the above results and with molecular modelling suggest thepossibility that p53 response elements possess a common characteristicsequence-directed flexibility that may be of critical importance in p53 DNA binding properties.
Our results suggest a model for p53-DNA interactions that includesboth highly specific protein-protein and protein-DNA interactions. Both ofthese may be modulated by sequence-dependent flexibility in the responseelement DNA such that stable complex formation may be directed by theconcerted actions of both direct and indirect recognition mechanisms.
References
1. Cho, Y. J., Gorina, S., Jeffrey, P. D., and Pavletich,
N. P., Crystal Structure of a p53 Tumor Suppressor DNA Complex: Understanding
Tumorigenic Mutations, Science 265, 5170, 346-355, 1994.
2. Balagurumoorthy, P., Sakamoto, H., Lewis, M. S., Zambrano, N., Clore,
G. M., Gronenborn, A. M. and Harrington, R. E., Four p53 DNA-binding Domain
Peptides Bind Natural p53-response Elements and Bend the DNA, Proc. Natl.
Acad. Sci. USA 92, 19, 8591-8595, 1995.
High Sensitivity Pure Nuclear Quadruple Resonance (PQR) in Biopolymers
Dmitri Ivanov and Alfred G. Redfield
MS 009,
Brandeis University,
Waltham, MA 02254 USA
PQR measures the electric field gradient at a nucleus, reflecting changes in non-S orbitals and charges surrounding it. We are developing this spectroscopy as a tool to study Mg, Zn, Ca, B, 17O and other 3/2 or spin 5/2 nuclei in proteins. By direct observation of PQR frequency we can get a sensitive indication of perturbation at these nuclei due to changes in structure or ligation. We have built a field-cycling system inside a 500 Mhz magnet, based on pneumatic shuttling in a flow system operating between 10 and 40°K. Protons are the reporters, polarized at 11.7 T, then shuttled to zero field above the top of the magnet adiabatically, and back to high field for FID readout, after a few seconds. In zero field a modulated search field is applied and when the PQR resonance is achieved, there will be a dip in the signal. (See, for example, Notter et al., Z. fur Naturforschung A49, 47, (1994) and references therein.) We have assembled the spectrometer and have obtained broad PQR spectra of 1 M boric acid and of natural abundance 17O in water glycerol mixtures, and we are now working on improving sensitivity to the millimolar range.
NMR Studies on the Slipped-Loop Structure of DNA in Solution
Nikolai B. Ulyanov, Valery I. Ivanov* & Thomas L. James
Department of Pharmaceutical Chemistry,
University of California,
San Francisco, CA 94143-0446
*V.I. Engelhardt Institute of Molecular Biology,
Russian Academy of Sciences,
117984 Moscow
Slipped-Loop Structure (SLS) is a special class of nucleic acid pseudoknot structures, which has been originally proposed as alternative folding for short direct repeats in DNA in order to explain the hypersensitivity of such repeats to S1 nuclease cleavage in supercoiled plasmids [1]. A number of experimental and theoretical investigations has demonstrated that this motif can be stable for specially designed model oligonucleotides [2-4]. Here we will present results of high-resolution NMR study on such a model. Careful design of model SLS DNA as symmetric homo-dimer of 25-residue oligonucleotide with optimization for proton chemical shift dispersion made it possible to obtain nearly complete proton assignments even with homonuclear NMR methods. Noesy experiments in water indicate that all tertiary base pairs are formed according to the SLS motif. However, not unusually, a symmetric homo-dimer of two DNA strands can potentially fold in more than one tertiary structure. In our case, two potentially possible tertiary structures have the same secondary structures (base pairing schemes), both consistent with the SLS motif. We will show how these tertiary structures can be distinguished by partial deuteration of eighth positions of purines, and present the results of structural refinement of the SLS DNA in solution, which is underway.
References
1. Mace H. A. F., Pelham H. R. B. & Travers A. A.,
Nature 304, 555-557 (1983).
2. Gorgoshidze M. Z., Minyat E. E., Gorin A. A., Demchuk E. Ya., Farutin
V. A. & Ivanov V. I., Molekulyarnaya Biologiya 26, 832-838
(1992).
3. Ulyanov N. B., Bishop K. D., Ivanov V. I. & James T. L., Nucl.
Acids Res. 22, 4242-4249 (1994).
4. Minyat E. E., Khomyakova E. B., Petrova M. V., Zdobnov E. M. & Ivanov
V. I., J.Biomolec. Struct. Dynam. 13, 523-527 (1995).
Sequence Specific Recognition in the DNA Minor Groove: X-Ray Structure of the Di-imidazole Lexitropsin Bound to C-A-T-G-G-C-C-A-T-G
Mary L. Kopka(1), Gye Won Han(1), Thang Chiu(1), David
S. Goodsell(2), J.W. Lown(3) and Richard E. Dickerson(1)
(1)Molecular Biology Institute,
University of California at Los Angeles,
Los Angeles, California 90095 USA
(2)Scripps Research Institute,
La Jolla, California 92037
(3)University of Alberta,
Edmonton, Alberta Canada
The pattern of hydrogen bond acceptors and donors on the floor of the minor groove of DNA is such that differentiating an AT from a TA base pair or GC from a CG base pair has not been possible. This degeneracy has been addressed by the side-by-side binding of polyamide drug ligands in the minor groove. Until recently, only AT or TA base pairs could be read by ligands like netropsin and distamycin. By replacing the pyrrole rings of the naturally occuring antibiotic netropsin with imidazole, it now becomes possible to accomodate the guanine N2 amine group which interfered with netropsin binding. The imidazole nitrogen can now hydrogen bond with the guanine N2. The 2:1 drug:DNA crystal structure of the diimidazole lexitropsin bound to C-A-T-G-G-C-C-A-T-G forms a side-by-side homodimer (figure) with each strand read individually. The ability to read each strand opens the door to selecting an adenine over a thymine and vice-versa. In this structure one ligand binds to the sequence GGCC on one strand and the other binds to CATG on the second strand. By carefully positioning imidazole next to pyrrole in the side-by-side arrangement, a CG base pair can be differentiated from a GC pair. Rules for differentiating base pairs as well as a structural explanation for guanine recognition are addressed in this x-ray analysis of the diimidazole/DNA complex. The ability to selectively target and read a DNA sequence of one's choice is becoming a foreseeable reality. Improved drug design, using linkers and hairpins is already being tested.
The Folding Pathway of a Group
II Intron Ribozyme Revealed by Stopped-Flow Fluorescence Spectroscopy and
Chemical Modification Footprinting
Peter Zhifeng Qin(2) and Anna Marie Pyle(1)
(1)Department of Biochemistry and Molecular Biophysics,
(2)Department of Applied Physics,
Columbia University,
New York, N.Y. 10032 USA
The tertiary folding of group II introns is stabilized by a variety of interactions, rendering it an excellent model system for studying the general principles of RNA folding. To study the Group II intron folding pathway, a multi-component ribozyme system has been derived from the ai5g group II intron, which contains a Domain 1 (D1) and domain 5 (D5) complex as the enzymes, and a short oligonucleotide as substrate (S). Stopped-flow fluorescence spectroscopy has been applied to monitor D1 folding and S binding in real time. Together with chemical modification footprinting, it is shown that in presence of Mg2+, D1 can independently fold into the correct conformation to bind S without assistance from other catalytically essential domains (D5, D3). As D1 encompasses both exon binding site 1 and 2 (EBS 1, 2) as well as several phylogenetically covariant elements, it is proposed that D1 serves as a tertiary scaffold onto which other domains assemble. Folding of D1 was further studied using truncation mutants. These results suggest that a specific element within D1 (the a - a' interaction) serves as the linchpin for initiating proper folding. Energetic studies of the two substrate recognition helices showed that while each helix is as strong as what one expects from base pairing, the total binding energy of full length substrate is significantly lower, leading to high specificity for substrate recognition. Chemical modification revealed a D1 conformation change upon substrate binding, which could account for the energetic penalty. The two helices seem to form independently with a bend between them. This is now being investigated by time-resolved fluorescence resonance energy transfer.
RNA Pseudoknot From Beet Western Yellow Virus at 1.9 Å Resolution
Li Su, Liqing Chen and Alexander Rich
Department of Biology,
Massachusetts Institute of Technology,
Cambridge MA 02139
The RNA pseudoknot is a very important tertiary motif widely found in virtually every class of RNA. In this motif, nucleotides from the loop region of a hairpin pair with a single stranded region outside the hairpin to form a quasi-continuous helix with loops crossing the major and minor groove. This unique structural motif is recognized by certain proteins and translational components to regulate translation on frameshifting and suppression. Furthermore and in particular, recent evidence shows that pseudoknots are potent inhibitors of the reverse transcriptase of HIV, the virus that causes AIDS. To date, no detailed information of the geometry of this motif at atomic resolution is available.
We were able to produce highly ordered single crystals of an RNA pseudoknot from Beet Western Yellow virus. This pseudoknot fragment is 28 nucleotides in length and involved in the translational frameshifting of open reading frames 2-3 to produce a fusion protein. The large amount of RNA used for crystallization was produced by the T7 RNA polymerase in vitro transcription system. Crystals of two different forms were obtained. One crystal lattice is trigonal, space group P3(2)21, unit cell a=30.84, b=30.84, c=144.55, a=90.0, b=90.0, g=120.0, with 1 molecule in the assymetric unit. The diffraction limit is 1.9 Å, which is well beyond the resolution of crystals of comparable RNA molecules such as tRNA (2.8 Å) and ribozymes (2.6 Å). The other crystal form is cubic, I23, a=b=c=108.9, diffraction limit 2.8 Å. Structure analysis is proceeded with the Multiple Anomalous Dispersion method by a Bromo-uridine derivative. Concurrently, we performed Rnase mapping and chemical modification studies to probe the tertiary interactions in solution. The comparison of the pseudoknot structure in the two crystal forms along with the biochemical studies allows us to gain sufficient knowledge of this motif.
The Sequence Dependence of Branch Migratory Minima
Weiqiong Sun, Chengde Mao and Nadrian C. Seeman*
Department of Chemistry,
New York University,
New York, NY 10003, USA
*Author to whom correspondence should be addressed. Phone: 212-998-8395;
Fax: 212-260-7905; E-mail: ned.seeman@nyu.edu.
The Holliday junction is a 4-armed branched DNA structure that is a fundamental intermediate in the process of genetic recombination. The branch points of naturally occurring Holliday junctions are flanked by homologous (twofold) sequence symmetry. This symmetry permits the branch point to relocate by means of an isomerization known as branch migration. This fundamental transition of the Holliday junction is a key step in recombination, because the products of recombination are a function of the extent of migration. Models of branch migration require knowledge of the free energy profile of the migratory pathway. We have asked the question diagrammed below: Are all sites along a migratory pathway equivalent, or do the sites differ as a function of the sequences that flank them?
We have examined this issue in symmetric immobile junctions, which are double crossover molecules designed to immobilize a symmetric junction-flanking sequence. We have equilibrated every symmetric immobile junctions with an immobile junction, and we have quantified the products of the reaction shown below, where J1 represents the immobile junction and i and j are symmetric nucleotides:
We have performed experiments to measure DG for all 16 pairs of i and j. Relative free energies are estimated by calculating DDG between different pairs of i and j. We have also varied the temperature of our experiments in order to estimate DDH and DDS for each reaction. Our data support a model in which the sequence affects the depth of the minimum. At 4 °C we find a range of about 1.3 kcal/mole amongst the different sequences that flank the branch point. It is clear that accurate stepwise modeling of the kinetics of branch migration should incorporate the sequence dependence of the individual steps.
This research has been supported by grant GM-29554 from
the NIH.
The Construction of Borromean Rings from DNA
Chengde Mao, Weiqiong Sun and Nadrian C. Seeman*
Department of Chemistry,
New York University,
New York, NY 10003, USA
*Author to whom correspondence should be addressed. Phone: 212-998-8395;
Fax: 212-260-7905; E-mail: ned.seeman@nyu.edu.
Borromean rings are a rich family of topological structures whose simplest member appears on the coat of arms of the Borromeo family, prominent in the Italian Renaissance. Although linked together, removal of any individual circle unlinks the remaining rings. Molecules with the Borromean property present a formidable synthetic task, because their assembly entails placing nodes with equal numbers of positive and negative signs specifically about a link. The half-turn of double helical DNA provides nodes for topological construction, whose signs can be imposed by choosing B-DNA (negative) or Z-DNA (positive). We have used this strategy to fashion trefoil or figure-8 knots from single-stranded DNA and RNA. We have now used this approach to craft Borromean rings from DNA. For stability, we have replaced each of the nodes of traditional Borromean rings with three nodes derived from 1.5 turns of DNA. These domains have been condensed into two 3-arm DNA branched junctions, one consisting of B-DNA and the other of Z-DNA. The three strands of each junction contain an octanucleotide on one end and a hairpin lacking an octanucleotide on the other end. The octanucleotides complement hairpins from the opposite junctions, so they can be ligated together in Z-promoting conditions to form three cyclic molecules. The hairpins do not contribute to the overall topology of the link, but they contain restriction sites, so that the cyclic molecules could be cleaved individually to demonstrate the Borromean properties of the link. The overall strategy should be transferable to other topological systems: It consists of [1] identifying components to serve as positive and negative nodes, [2] their linkage in stable units (branched junctions here), followed by [3] recognition-directed ligation.
This research has been supported by grants from the NIH and ONR.
Direct Evidence for Holliday Junction Crossover Isomerization
Xiaojun Li, Hui Wang and Nadrian C. Seeman*
Department of Chemistry,
New York University,
New York, NY 10003, USA
*Author to whom correspondence should be addressed. Phone: 212-998-8395;
Fax: 212-260-7905; E-mail: ned.seeman@nyu.edu.
The Holliday junction is a key intermediate in genetic recombination. This is a four-stranded branched DNA structure, whose double helical arms are stacked in two domains; two of the strands are roughly helical, and the other two cross over between domains. Switching the strands between these two roles is known as crossover isomerization; this postulated reversal is thought to be one of the key transformations that the Holliday junction can undergo, because it can lead to changing the products from patch to splice recombinants. We present direct evidence that this reaction can indeed occur in Holliday junctions in solution. We have constructed a double crossover molecule containing a branched junction, constrained not to be in its favored conformation. This junction is released from the double crossover molecule by digestion with restriction endonucleases. We demonstrate by means of hydroxyl radical autofootprinting that the junction changes its crossover isomer spontaneously when released from the double crossover. We control for the possibility that the experimental protocol causes the isomerization. We also exclude dissociation and interaction with other molecules in solution as contributing to the phenomenon. Thus, crossover isomerization is an authentic spontaneous transformation of Holliday junctions.
This research has been supported by grant GM-29554 from
the NIH.
The Incorporation of DNA Double Crossovers into DNA Triangles
Xiaoping Yang, Jing Qi, Xiaojun Li and Nadrian C. Seeman*
Department of Chemistry,
New York University,
New York, NY 10003, USA
*Author to whom correspondence should be addressed. Phone: 212-998-8395;
Fax: 212-260-7905; E-mail: ned.seeman@nyu.edu.
There are at least three properties necessary for the components of systems to be used for the rational assembly of periodic matter: [1] The predictable specificity of intermolecular interactions between components; [2] the structural predictability of intermolecular products; and [3] the structural integrity of the components. From the perspective of the first two points, DNA branched junctions are ideal molecules for this purpose: Sticky ended association is a highly specific interaction that is readily programmed; likewise, the local end product of ligation is B-DNA, whose structure is well-characterized. Unfortunately, the angles between the double helical arms that flank the branch points of junctions are not well-defined. Consequently, we have sought less flexible DNA motifs for this purpose. We have previously characterized the DNA double crossover molecule (DX) as behaving stiffly in ligation-closure experiments [Li, X., Yang, X., Qi, J. & Seeman, N.C., J. Am. Chem. Soc. 118, 6131-6140 (1996)].
Triangles in two dimensions and deltahedra in three dimensions are likely to provide the most rigid species for purposes of nanoconstruction. Consequently, we wish to determine whether the DX motif can maintain its structural integrity when incorporated as one or more edges of a triangle. We have built DNA triangles that contain DX molecules on one or two edges. These are antiparallel DX molecules containing one helical turn between crossover points (DAE). This topology leads to a reporter strand that facilitates interpretation of the ligation experiment. The corners of the triangles are derived from dT6 bulges. Each molecule is assembled in a modular fashion as a topologically closed species, except for the small circles at the centers of the DAE molecules. Each outer domain is bounded by a hairpin. As shown below, when a particular pair of hairpins is designated for removal by restriction, a biotin is attached to them during synthesis. The molecule is then restricted, hairpins and incompletely restricted species are removed by streptavidin bead treatment, and the triangles are ligated together. We are able to ligate as many as 27 triangles linearly on either edge without the appearance of cyclic material. This finding suggests that the presence of triangular species attached to one domain of a double crossover molecule does not affect the structural integrity of the other domain. We hope this property can be utilized to construct two dimensional periodic matter from a triangular DNA motif.
This research has been supported by grants from the NIH
and ONR.
Lengthening Sticky Ends: Not as Easy as it Looks
Furong Liu, Hui Wang and Nadrian C. Seeman*
Department of Chemistry,
New York University,
New York, NY 10003, USA
*Author to whom correspondence be addressed. Phone: 212-998-8395; Fax: 212-260-7905;
E-mail: ned.seeman@nyu.edu.
Sticky ends are the key to programming the associations of double helical DNA molecules. Sticky-ended ligation is arguably the fundamental reaction of biotechnology. DNA branched junctions containing such sticky ends can be assembled to form stick figures whose edges consist of double helical DNA, thus leading to a DNA nanotechnology. Molecules whose helix axes have the connectivity of a cube and of a truncated octahedron are examples of DNA polyhedra constructed in this way. A second application of DNA sticky ends is in DNA-based computing. For example, Winfree has suggested that antiparallel DNA double crossover molecules with an appropriate set of sticky ends could act as cellular automata and thereby be used to perform calculations [Winfree, E., In: DNA Based Computers, ed. by R.J. Lipton and E.B. Baum, Am. Math. Soc., Providence (1996), pp. 199-221].
We have found that the most effective means to assemble and purify complex DNA motifs is in the form of topologically closed products. For example, the truncated octahedron was assembled as a 14-catenane of DNA. In order to ligate a topologically closed molecule to another molecule, it must contain restrictable hairpins, whose cleavage exposes a sticky end. It would be desirable to prepare sticky ends of arbitrary lengths, in order to increase both the cohesion and the specificity of the sticky ended interactions. The value for DNA-based computing is evident: Longer sticky ends lead to a greater diversity of species. For DNA construction, longer sticky ends provide greater stability in intermolecular interactions. Asymmetric sticky ends, which yield the greatest specificity derive from enzymes with interrupted sites or those that cleave distal to their site. Other than TspR I, which loses activity below 65°C, no restriction enzyme produces an asymmetric site with greater than four nucleotides.
We have worked out a means to extend short asymmetric sticky ends. One might imagine that all one need do is to add a single strand complementary to the overhang. However, such a simple protocol generates very little target product. Better results are obtained when the strand to be ligated is added as a duplex, except for the overhang. However, the cleanest results are seen when the complement contains a hairpin to stack on the added strand, as illustrated below. The complementary strand is readily removed if it contains a biotin group so that treatment with streptavidin beads can be used to bind it. We expect that this protocol will be of use in the addition of long sticky ends to DNA building blocks in DNA nanotechnology and DNA-based computing.
This research has been supported by grants
from the NIH and ONR.
Detection of a B-Form/A-Form Junction in DNA
V.I. Ivanov and L.E. Minchenkova
The Engelhardt Institute of Molecular Biology,
Russian Academy of Science,
117984 Moscow, Russia
Gunther Burckhardt, Eckhardt Birch-Hirschfeld, Hartmut
Fritzsche and Christoph Zimmer
Institute of Molecular Biology,
Friedrich-Schiller University,
D-07745 Jena, Germany
The problem of biological role of the DNA A-form is intimately associated with the structure and energetics of the B/A junction. Especially important in this connection are the recently published X-ray data on the emergence of the B/A junction in a DNA complex with reverse transcriptase of HIV (1) and the emergence of an A-like conformation in CRP complexes with certain binding sites (2). To have the immobile B/A junction in a free DNA, we designed and synthesized two complementary 14-meric deoxyoligonucleotides, capable of forming the duplex:
5'ACCCCCTTTTTTTG
TGGGGGAAAAAAAC 5'
The transition of this duplex from the B to A conformation in water/trifluorethanol (TFE) solution was studied with the use of circular dichroism. Increase in the TFE fraction induces a two-step B-A transition. In the first step, up to 73% TFE,the A-form is generated from the GC-rich part; in the second one, 73% to 82% TFE, the AT-rich part shifts to the A-form. So, a B/A junction must exist in the vicinity of 73% TFE. Emergence of the B/A junction has been directly confirmed with the use of Distamycin A and Netropsin, the ligand known to selectively bind to AT-stretches of the B-form of DNA. Free energy value for the B/A junction was estimated to be 2.1kcal/mol that agrees with the known data for polymeric DNAs.
Supported by RFBR and DFG
References
1. Jacobo-Molina, A. et al., PNAS 90, 6320-6324
(1993).
2. Ivanov, V. I. et al., J. Mol.Biol. 245, 228-240 (1995).
3. Ivanov, V. I. et al., Biophys. J. 71, 3344-3355 (1996).
The Structure and Properties of a Small, Porphyrin-Metallating, DNAzyme
Dipankar Sen and Yingfu Li
Inst. of Molecular Biology & Biochemistry
Simon Fraser University
Burnaby, B.C. V5A 1S6 Canada.
The properties of a porphyrin-metallating DNA enzyme (PS5.ST1, a 33mer), that we had selected by virtue of its preferential binding to N-methyl mesoporphyrin (NMM-- a transition state analog for porphyrin metallation), was investigated, in terms of establishing both the 'core' catalytic sequence, and finding the optimal conditions for catalysis. Thus, a 24-nucleotide sequence, PS5.M, from within PS5.ST1, was found to catalyze the insertion of Cu(II) ions into mesoporphyrin IX (MPIX) with a kcat value of 1.3 per minute, and a KM value of 40 micromolar. These numbers compared quite well with those of naturally occurring ferrochelatase enazymes.
A guanine-quadruplex based structural model was proposed as the active folded structure of the DNAzyme, on the basis of DMS-footprinting and catalytic activity assays of PS5.ST1, PS5.M, and various mutated sequences. The absolutely minimal catalytic sequence was both predicted and tested to be only 16 nucleotides long; in addition, the reverse sequence of PS5.M was also found to be catalytic, indicating a symmetry in the folded structure. A small change in the sequence of the non-NMM-binding and non-catalytic 'thrombin aptamer' converted it into a catalyst for porphyrin metallation.
Spectroscopic studies indicated that the DNAzyme-MPIX complex
has a visible spectrum close in many respects to that of the transition-state
analogue, NMM, although significantly different from the spectra of MPIX
itself. This seems to corroborate the idea that the DNAzyme likely accelerates
the metallation reaction by distorting the ground-state porphyrin substrate
to the transition state for metallation.
DNA Sequence and Three-dimensional Structure
Wilma K. Olson
Department of Chemistry,
P.O. Box 939,
Rutgers University,
Piscataway, New Jersey 08855-0939
The idea that DNA base sequence is more than a carrier
of the genetic blueprint first arose from statistical analyses of residue
occurrences in natural nucleotide sequences. The bending, twisting, and
stretching observed at individual residues in nucleic acid crystal structures
have shed important clues for deciphering the spatial code hidden within
the double helix. This sequence-dependent structural heterogeneity, while
less impressive on a local structural scale than that observed in proteins,
plays a crucial role for all processes involving DNA recognition. As part
of a program to understand how local base sequence effects reveal themselves
in the structure of the long threadlike polymer, we have been developing
knowledge-based "energy" functions of the local angular and translational
movements of adjacent bases pairs and new computational tools for optimizing
the configurations of long closed circular and looped chain molecules based
on these data. The energies are based on harmonic analyses of the base pair
parameters in structures stored in the Nucleic Acid Database. The polymer
computations are a simple application of the theory of anisotropic elastic
rods.. The long DNA molecule is divided into a finite number of segments,
the physical properties and shapes of which can differ from one unit to
the next. The three-dimensional arrangements and associated energies of
the system as a whole are expressed in terms of the natural bending, twisting,
and stretching of the units. The effects of external forces, such as those
which might be associated with binding proteins and long-range self-contacts,
can also be included. The energetically preferred configurations of the
system are then obtained by numerical solution of a set of non-linear algebraic
equations. The local conformational mechanics of neighboring base pairs
not only determines the secondary structure of successive residues but also
mediates the folding and interactions of long chain fragments. In other
words, bound proteins and/or native sequence help to determine which parts
of the DNA will influence one another; without such guidance, widely separated
parts of the long chain molecule might have little or no contact. Thus,
the specific geometry of a long sequence of base pairs in one part of the
DNA polymer can potentially affect actions at other sites.
A Cofactor-Independent DNAzyme for RNA Hydrolysis
Dipankar Sen and C. Ronald Geyer
Institute of Molecular Biology and Biochemistry
Simon Fraser University,
Burnaby, BC, Canada V5A 1S6
A widely held view about ribozymes is that they are necessarily metalloenzymes. We wished to investigate whether this was necessarily so. We carried out in vitro selection on a random pool of single stranded DNA molecules to screen for DNAs that could catalyze the cleavage of an RNA phosphodiester in the absence of external catalytic cofactors, such as divalent cations or polyamines. 12 rounds of selection and amplification yielded catalytic DNAs that cleaved an RNA phosphodiester ~ 10**7 fold faster than the spontaneous rate of cleavage of a dinucleotide (ApA), under comparable conditions [1].
One sequence from the above selection was randomized with a 15% degeneracy and re-selected for RNA cleavage catalysis. The refined sequences obtained cleaved an RNA phosphodiester at ~0.01 min-1, representing a ~ 10**8 fold rate-acceleration over the uncatalyzed rate of hydrolysis.
This DNAzyme required monovalent cations for efficient
catalysis, but had no requirement for any divalent or higher-valent cation.
Kinetic and pH-dependence studies revealed that the rate limiting step did
not involve acid- base catalysis. To our knowledge, this is the first example
of a cofactor-independent ribozyme for phosphodiester hydrolysis, one that
catalyzes hydrolysis without the help of either multivalent metal ions and/or
polyamines. The finding that folded nucleic acids by themselves can contribute
significantly towards this catalysis throws new light on the enzymatic requirements
for RNA hydrolysis.
1. Matsumoto, Y. & Komiyama, M., J. Chem. Soc. Chem.
Commun.1050-1051 (1990).
Manipulation of Curvature in Plasmid DNA Molecules
Nancy C. Stellwagen* and Kurt Strutz
Department of Biochemistry
University of Iowa
Iowa City, Iowa 52242 USA
The circular permutation assay has been used to indentify apparent bend centers in plasmids pUC19 and Litmus 28. Two major and two minor bend centers are observed in each plasmid; the major bend centers are located near the origin(s) of replication and the promoter of the ampicillin resistance gene in pUC19. The locations of the apparent bend centers are independent of gel concentration, buffer concentration and type, temperature, and the presence or absence of various monovalent cations and anions. However, some of the bend centers are displaced to different locations when physiological concentrations of Mg++ or Ca++ are added to the buffer. The displacement is cation specific; similar results are no t observed when similar concentrations of Ba++ or Zn++ are added to the buffer. The major bend center corresponding to the M13 origin in Litmus 28 can be inserted into the polylinker region of pUC19; the resulting construct contains 3 major bend centers. The sequence-dependent location of the third bend center (M13 origin) in the pUC19 construct does not depend on the size of the insert, unless the bend center itself is bisected. Hence, the location of the apparent bend centers in kilobase-sized DNA molecules is DNA sequence, not DNA context, depen dent. The apparent bend centers can also be displaced or eliminated by suitable restriction enzyme digestion and religation. The combined results suggest that curvature in plasmid DNA molecules can be manipulated by various methods and the results can be characterized by the circular permutation assay. Supported by Grant GM29690 from the National Institute of General Medical Sciences.
*Author to whom all correspondence should be addressed. Phone: 319-335-7896; Fax: 319-335-9570; E-mail: Stellwag@blue.weeg.uiowa.edu
Selforganization of Nucleic Acids Visualized by Scanning Force Microscopy
C. Bohley(1), W.-V. Meister(1*), G. Bischof(1), R. Bischoff(2),
S. de Bambirra(1), S. Lindau(1), S.Kargov(4), J. Barthel(3) and S. Hoffmann(1*)
Martin Luther University Halle-Wittenberg
(1*)Institute of Biochemistry,
06120 Halle (Saale), Germany,
Phone.: ++49-345-55 248 55, Fax.: ++49-345-55 270 11, E-mail:meister@biochemtech.uni-halle.de
(2)Department of Oto-, Rhino-,
Laryngology, Face and Neck Surgery,
06110 Halle (Saale), Germany
(3) Max Planck Institute of Microstructure Physics,
06120 Halle(Saale), Germany
(4) Moscow State University,
Faculty of Chemistry, 119899
Moscow, Russia
While suitably designed nucleic acids display broad spectra of complex, also biologically meaningful mesophase behavior [1-3], little is known about the distinct molecular orientations within the different mesomorphic organizations in bulk and interface appearances. In addition to the extensive investigations of single molecule moieties by molecular resolving microscopies, Scanning Force Microscopy (SFM) studies visualize here for the first time DNA and RNA single-, double-, triple- and quadruple-strand patterns in selforganized adlayers. Together with texture observations by polarizing microscopy and assisted by computer simulations, the results reveal first orientational insights into the selforganizational behavior of nucleic-acids domains and microdomain arrangements in mesomorphic states, which - on the basis of forthcoming improvements in technical equipment - might further be extended to a more thorough view of nucleic acid structure-phase dualities. [1,2]
References
1. a)S. Hoffmann, W. Witkowski; Biomesogens and their models,
in Mesomorphic Order in Polymers and Polymerization in Liquid Crystalline
Media (A. Blumstein, ed), Am. Chem. Soc. Symp. Ser. 74 (1978) 178-236.
b) S. Hoffmann, Mesogenic order-disorder distributions, in Polymeric Liquid
Crystals (A. Blumstein, ed.), Plenum Press, Science and Technology 28
(1985) 423-452. c) S. Hoffmann, Molecular Matrices (I. Evolution II. Proteins,
III. Nucleic Acids, IV. Membranes) Akademie-Verlag, Berlin 1978
2. S. Hoffmann, Overview to the quest of selfreproduction and artificial
life, in Self-production of Supramolecular Structure (G. R. Fleischaker,
S. Colonna, P. L. Luisi, eds.), Kluwer Acad. Publ., Dordrecht-London-New
York, NATO ASI Ser. 446 (1994)
3. -22 3 J. Frommer, Angew. Chem., 104 (1992) 1325-1357 , Angew.
Chem. Int. Ed. Engl. 30 (1992) 1298-1328
Possibilities of Triplex-Formation by Short Oligo(deoxy)nucleotide Analogs of Tetrahymena pre-rRNA Fragments
W.-V. Meister(1*), G. Bischoff (1), R. Bischoff (2),
C. Bohley(1), S. de Bambirra(1), E. Birch-Hirschfeld (3), S. Kargov(4) and
S. Hoffmann(1*)
Martin Luther University Halle-Wittenberg
(1*) Institute of Biochemistry, 06120 Halle (Saale), Germany
Phone: ++49-345-55 248 55, Fax.: ++49-345-55 270 11, E-mail: meister@biochemtech.uni-halle.de
(2) Department of Oto-, Rhino-, Laryngology, Face and Neck Surgery,
06110 Halle (Saale), Germany
(3) Friedrich Schiller University,
Institute of Virology,
07745 Jena,Germany
(4) Moscow State University,
Faculty of Chemistry,
119899, Moscow, Russia
A series of different 14- and 21-mer oligo(deoxy)nucleotide analogs - covering patterns of internal-guide and intervening sequences as well as adjacent 3 - and 5 - exon parts around the splicing site of Tetrahymena pre-rRNA [1,2] - was synthesized. UV-absorption thermal denaturation studies, CD-spectroscopy, Scanning Force Microscopy, polyacrylamide gel electrophoresis and molecular modelling were used to study the possibilities of (partial) triplex formations by these strands taken in various combinations. Different stabilities of triplex formation, elucidated from thermal denaturation studies, are compared with corresponding computer simulations and discussed as to biological inferences.
References
1 S. Hoffmann, On the self-splicing complex of Tetrahymena
pre-rRNA., II Swedish- German Workshop on Modern Aspects of Chemistry and
Biochemistry of Nucleic Acids and Their Components (H. Seliger, ed.), Nucleosides
& Nucleotides, 7 (1988) 555-558.
2 T. Inouie, F. X. Sulivan, T. R. Cech, J. Mol. Biol. 189 (1986)
143-159 Selforganization of Nucleic Acids Visualized by Scanning Force Microscopy
Mesogenic 2-Pyridones and 1,2-Diacylhydrazines Modelling Aspects of Recognition and Modulation in Nucleoprotein Replication Systems
C. Bohley(1), S. Naumann(2), S. Lindau(1), S. de Bambirra(1),
W.-V. Meister (1*) and S. Hoffmann(1*)
Martin Luther University Halle-Wittenberg
(1*) Institute of Biochemistry,
06120 Halle (Saale), Germany
Phone: ++49-345-55 248 55, Fax.: ++49-345-55 270 11, E-mail: meister@biochemtech.uni-halle.de
(2)Institute of Chemistry,
06120 Halle (Saale), Germany
Molecular recognition and modulation exert essential roles in nucleoprotein replication systems. While RNA to a certain degree will cover both aspects, the developed nucleoprotein systems seem to afford the modulatory power of a 20-side-chain- and extended hydrogen-bonding-backbone instrumentary of proteins for successfully replicating DNAs. Extended versions of hydrogen-bonded 2-pyridone dimers (less probably multimers) and 1,2-diacylhydrazine multimers display by the action of their nucleic-acid-like frontal and their protein-like lateral recognition systems of cis- and trans-amide groups, respectively, a different mesophase behavior, that reflects the mutual aptness for recognition and modulatory roles. The extensive mesophase elucidations by polarizing and molecular resolving microscopies, DSC and X-ray investigations, also discussed in light of corresponding molecular modelling and additionally visualized in video-tapes, allow for insights into the structure-phase-dualities involved.
References
1 S. Hoffmann, Angew. Chem. 104 (1992) 1032-1035; Angew.
Chem. Int. Ed. Engl. 31 (1992) 1013-1016
2 S. Hoffmann, Overview to the quest of selfproduction and artificial life,
in Self-Production of Supramolecular Structure (G. R. Fleischaker, S. Colonna,
P. L. Luisi, eds.), Kluwer Acad. Publ. Dordrecht - London - New York, NATO
ASI Ser. 446 (1994) 3-22
3 D. Sievers, T. Achilles, J. Burmeister, S. Jordan, A. Terfort, G. von
Kiedrowski, Molecular replication: from minimal to complex systems, ibid.
45-64
Phase-Behavior of Long Alkyl-Chain Nucleobase Derivatives
S. de Bambirra(1), S. Lindau(1), G. Bischoff(1), R.
Bischoff(2), C. Bohley(1), L. Kovalenko(3), M. Madre(3), R. Zhuk(3) ,W.-V.
Meister(1*) and S. Hoffmann(1*)
Martin-Luther-University Halle-Wittenberg
(1*) Institute of Biochemistry,
06120 Halle (Saale), Germany,
Phone: ++49-345-55 248 55, Fax.: ++49-345-55 270 11, E-mail; meister@biochemtech.uni-halle.de
(2) Department of Oto-, Rhino-, Laryngology, Face- and Neck Surgery,
06110 Halle (Saale), Germany
(3) Institute of Organic Synthesis,
Aizkraukles 21, LV-1006 Riga, Latvia
Evolution developed informational and compartmental components from formally comparable building blocks. A limited 4(5)-letter alphabet of informational side-chains of nucleic acids corresponds to a huge amount of compartmental alkyl-chain variations in membranes, while the extended sugar and the short glycerol-phosphate backbones account for information stability and compartmentation lability. [1] It seemed tempting to combine the more hydrophobic parts of these differently shaped side-chain instrumentaries within molecular species that comprise, by this, patterns of both recognition and compartmentation facilities. A series of long-chain N-alkoxymethylene-adenine, -cytosine, -guanine and -thymine derivatives was synthesized as previously described [2] and investigated by polarizing and molecular resolving microscopies, DSC-measurements and X-ray investigations for potential mesophase behavior of their single-, double-, triple- and quadruple-base arrangements. Paralleled by the findings of Paleos et.al. [3] for comparable compounds, the here received data are indicative of an untypical mesophase (or solid state, respectively) behavior that might be attributed to some new sort of plastic phase. Assisted by molecular-modellings studies, the compounds are discussed for possible further applications.
References
1. a) S. Hoffmann, W. Witkowski; Biomesogens and their
models, in Mesomorphic Order in Polymers and Polymerization in Liquid Crystalline
Media (A. Blumstein, ed.), Am. Chem. Soc. Symp. Series 74 (1978) 178-236;
b) S. Hoffmann, Mesogenic order- disorder distributions, in Polymeric Liquid
Crystals (A. Blumstein, ed). Plenum Press, Science and Technology 28 (1985)
423-452; c) S. Hoffmann, Molecular Matrices (I. Evolution, II Proteins,
III Nucleic Acids, IV Membranes), Akademie-Verlag, Berlin 1978
2. M. Ya. Karpeisky, S. M. Mikhailov,. A. S. Ciemina, A. A. Ziderman, J.
M. Kravchenko, M. Yu. Lidak, R. A. Zhuk, Khim. Get. Soed. (Russ.) 11 (1980)
1541-1544 3 C. M Paleos,. D. Tsiourvas,. Angew. Chem. 107 (1995) 1839-1855,
Angew. Chem. Int. Ed. Engl. 34 (1995) 1696-1711
Message-Design Around the ss-Casomorphin Motif within ss-Casein Informational Tracts
W.-V. Meister(1*), F. Adler(1), E. Birch-Hirschfeld(2)
and S. Hoffmann(1*)
Martin Luther University Halle-Wittenberg
(1*) Institute of Biochemistry,
06120 Halle (Saale), Germany,
Phone: ++49-345-55 248 55, Fax: ++49-345-55 270 11, E-mail: meister@biochemtech.uni-halle.de
(2) Friedrich Schiller University,
Institute of Virology,
07745 Jena, Germany
Within complex regulation hierarchies, peptide linguistics of prohormonal polyproteins and their proteolytic information processings direct the messages of central regulation programs into highly differentiated and intimately interconnected program subroutines. Despite the uncertainties about their local information processings, their adressings of different receptor patterns and their involvements in both endogenous and exogenous regulation networks, ss-caseins display complex informational peptide patterns, that are suspicious for regulatory roles within neuroendocine, cardiovascular-cardiotonic, immunomodulatory and digestion mediatory programs [1,2]. Together with their accompagning informational tracts, ss-casomorphins as outstanding representatives of ss-casein informational patterns, serve initiatory roles for an artificial recombinant message-design of peptide regulides [3]. Based on computer simulations and additionally visualized by video-tapes, the statics and dynamics of the structurally and functionally optimised short-peptide messengers involved are discussed in terms of native importance, possible artificial interferences with and modulations of native bioregulators.
References
1. S. Hoffmann, E. Hoehne, G. Reck, D. Pfeiffer, W. Brandt,
K. Neubert, A. Barth; ss- Casomorphin - structural aspects, in Dipeptidyl
Peptidase IV (A. Barth, R. L. Schowen, eds.), Contributions to Drug Research,
Berlin-Friedrichsfelde 38 (1990) 226-257
2. S. Hoffmann, M. Koban, C. Liebmann, P. Menz, K. Neubert, A. Barth, Message-design
around the ss-casomorphin motif: A hypothetical basis for future research,
in ss-Casomorphins and Related Peptides (V. Brantl, H. Teschemacher, eds.),
VCH, Weinheim 1994, 125-134
3. W.-V. Meister, E. Birch-Hirschfeld, M. Koban, U. Schilken, G. Kunze,
R. Blasig, H. Reinert, E. Guenther, M. Strube, S. Hoffmann, Genetechnological
approaches to ss-casein patterns, ibid. 66-72
NMR Studies of the Conserved 43 Nucleotide RNA Domain Found in the Signal Recogniton Particle
Peter Lukavsky, Stefan Behrens, Todd Billeci, Thomas
L. James and Uli Schmitz
Department of Pharmaceutical Chemistry,
University of California,
San Francisco, CA 94143-0446
Recent work provides evidence that the molecular machinery for protein targeting, i.e. the signal recognition particle (SRP), is conserved in many species ranging from eubacteria to mammalian cells. Mammalian SRP and its homologues exhibit a phylogenetically conserved RNA domain (43-48 nt) whose secondary structure suggests a hairpin motif with two bulged regions separated by a three to four base pair stem. The end of the hairpin consists of a 5U-GnAA tetraloop which is a member of the family of 5U-GnPuA loop-closing sequences. The bulged regions interact with the particular domain of the SRP54 protein which is instrumental for signal sequence recognition. Structural studies of two RNA fragments with one or both of the conserved bulges are presented, comprising 28 and 43 nucleotides, respectively. The SRP RNA fragments exhibited a pronounced structural stabilization in the presence of Mg2+, evident from UV and NMR measurements [1]. Assignments of all base, H1U, H2U, and imino proton resonances as well as most of the amino proton resonances in the presence of Mg2+ were obtained for the 28mer RNA via homonuclear NMR methods. For the 43mer, assignments of most protons were obtained via heteronuclear NMR using several 13C,15N-labeled samples. Preliminary structural models will be presented. Mg2+ seems to stabilize the structure of one of the conserved bulged regions which involves G:A, G:G, and C:A mismatch pairs whereas the second unsymmetric bulge appears to be relatively unstructured, beside stacking interactions. The structural influence of the two bulges on each other will be discussed.
References
1. U. Schmitz, D.M. Freymann, T.L. James, R. J. Keenan,
R. Vinayak, and P. Walter, RNA, 2, 1213 (1996).
Energetics and Geometry of Water Clusters and Networks
Bernd U. Ihmels and D. Mario Soumpasis
Biocomputation Group,
Max Planck Institut for Biophysical Chemistry,
37070 Gttingen, Germany
We present results of an extensive study of water clusters and networks at biomolecular interfaces. They are based on ab initio calculations of 2--20 water molecules clusters and representative sets of empirical potentials currently used to describe water. Examples of the hydration of hydrophobic and hydrophilic host atoms by some of these water clusters will be shown. We discuss the interaction of the 20 amino acids with clusters of 20 water molecules and compare them to currently used hydrophilicity and hydrophobicity scales. Furthermore we provide several quantitative examples of the importance of hydrophilic water networks, which are necessary to compensate the unfavourable free energy of cavity formation in protein folding. In order to estimate many-body effects in liquid environments, we also performed calculations using the Potential of Mean Force framework [1, 2, 3], reviewed in [4, 5].
References
1. D. M. Soumpasis. Statistical mechanics of the B -->
Z transition of DNA: Contribution of diffuse ionic interactions. Proc.Natl.Acad.Sci.
USA, 81: 5116-5120, 1984.
2. G. Hummer, D. M. Soumpasis, and A.E. GarcÌa. Potentials of mean
force description of ionic interactions and structural hydration in biomolecular
systems. Biophys.J., 68:1639-1652, 1995.
3. A. E. GarcÌa, G. Hummer, and D. M. Soumpasis. Hydration of an
\alpha-helical peptide: Comparison of theory and molecular dynamics simulation.
Proteins, in press, 1997.
4. D. M. Soumpasis, A. E. Garcia, R. Klement, and T. M. Jovin. The potentials
of mean force (PMF) approach for treating ionic effects on biomolecular
structures in solution. In D. Beveridge & R. Lavery, editors, Theoreical
Biochemistry and Molecular biophysics, pages 343-360. Adenine Press NY,
1990.
5. D. M. Soumpasis. Formal aspects of the potential of mean force approach.
In D. M. Soumpasis and T. M. Jovin, editors, Computation of Biomolecular
Structures. Achievements, Problems and Perspectives. Springer Verlag, Berlin,
Heidelberg, 1993
Modeling DNA Structures: From Local to Superhelical Forms
A. R. Srinivasan and Wilma K. Olson
Department of Chemistry,
Wright-Rieman Laboratories
Rutgers, the State University of New Jersey,
New Brunswick, New Jersey 08903
Superhelical parameters (N-the number of base pairs in
one superhelical turn; H-the vertical displacement of residues along the
superhelix axis; R-the radius of the superhelix) of double-helical DNA structures
are investigated by modeling regular repeating sequences of the type XnY10-n.
The XX and the XY steps are assumed to be B-DNA like (twist = 36°; tilt
= roll = 0°; shift = slide = 0 Å; rise = 3.4 Å) and identical
base sequence dependent perturbations are introduced in the YY and YX steps.
Superhelical structures are generated as a function of twist, roll and slide.
Each superhelical repeating unit is identified by a virtual bond linking
the origins of the first and the eleventh base pairs. Perturbations are
confined, initially, within the limits observed from the analysis of single
crystal structures of DNA oligomers. Two sets of structures emerge with
dimensions close to the ideal nucleosome structure. These two groups with
opposite superhelical sense differ only by small changes in the independent
parameters. These models are used to study folding and nucleosome formation
of naturally occurring sequences. (Supported by USPHS Grant GM20861.)
Computer Simulations of Polynucleosomal DNA Circles
Vsevolod Katritch and Wilma K. Olson
Department of Chemistry,
Rutgers University,
P.O. Box 939, Piscataway,
NJ 08855-0939, USA.
The bridge between the local structure of the nucleosome and the high level organization of chromatin is key to understanding processes like replication and gene expression, that entail global topological rearrangements of protein-bound DNA.
Here we report a new computer algorithm which makes it possible to model long circular DNA molecules in aqueous solution with two or more positioned nucleosomes. The DNA chain is described by an elastic model with bending and twisting rigidity at the joints between constituent segments [1]. The path of the DNA wrapped around each nucleosome is "frozen" in the form of a regular superhelical segment with given values of pitch, radius, and number of turns. The rest of the chain, the linker DNA, is free to undergo thermal fluctuations. A simulated annealing procedure with temperature decreasing slowly towards zero is applied to the system in order to identify the minimum energy configurations of the chain. We obtain starting configurations from previous studies of the equilibrium structures of nucleosomal DNA [2-4] and verify the earlier results. We find that even in the simple case of dinucleosomal DNA at least two distinct minimum energy configurations can exist. The two structures differ dramatically in terms of overall spatial shape and topological features, with writhing numbers, Wr, differing by about 1. In the case of three and more nucleosomes the pattern of energy minima is more complicated and depends crucially on the geometry of the nucleosome.
In addition to the minimum energy search, we monitor the fluctuations of the DNA-nucleosome complexes at thermal equilibrium using Metropolis-Monte Carlo methods. The bimodality of the distribution of the writhing number confirms that the overall shape of the dinucleosome-DNA complex interconverts between two families of configurations corresponding to the two local elastic minima. In both the di- and multi-nucleosome cases, the average writhing number calculated for the whole population of molecules is almost always significantly smaller than the "static" value of the writhing number, calculated as the value of Wr of one nucleosome multiplied by the number of nucleosomes. This result provides (at least partially) a natural explanation for the so-called "linking number paradox" and shows that a simple static representation of chromatin structure in many cases does not predict the average characteristics of the protein-bound DNA in solution, even as a first approximation.
References
1. Katritch, V. & Vologodskii, A. V. (1997). The effect
of distributed intrinsic curvature on conformational properties of circular
DNA. Biophys. J., in press.
2. Zhang, P., Tobias, I. & Olson, W. K. (1994). Computer simulation
of protein-induced structural changes in closed circular DNA. J. Mol.
Biol. 242, 271-290.
3. Olson, W. K., Westcott, T. P., Martino, J., A. & Liu, G.-H. (1996).
Computational studies of spatially constrained DNA. In Mathematical Approaches
to Biomolecular Structure and Dynamics (Mesirov, J. P., Schulten, K. &
Sumners, D., eds.), pp. 195-217. Springer-Verlag, New York.
4. Martino, J. A. & Olson, W. K. (1997). Modeling protein-induced configurational
changes in DNA minicircles. Biopolymers, in press.
Slipped Loop Structure (SLS) in Symmetrical Deoxynucleotides
E. E. Minyat, E. B.Khomyakova, M. V.Petrova and V. I.
Ivanov
Engelhardt Institute of Molecular Biology,
Russian Academy of Sciences,
32 Vavilova str., Moscow 117984 Russia
The earlier obtained by us data show that the Slipped Loops Structure (SLS) can exist (1, 2, 3). This new type of DNA or RNA chains folding occurs when two shifted loops protrude from the opposite chains of a double-helical fragment while the sequences of these loops can form an additional duplex between them. Currently we investigate the SLS duplexes made of identical (or nearly identical) chains containing self-complementary parts as a convenient model for the formation of SLS, in particular for NMR and chemical modification studies. However, any sequence can form a number of alternative structures. It is necessary therefore to discriminate these structures. We designed and synthesized four short deoxyoligonucleotides, called SLS25, SLS25t, SLS31(a), SLS31(b). The figures 25 or 31 indicate the length of the oligonucleotide. The SLS25 and SLS25t are symmetrical structures formed by the interaction of two identical strands. SLS25t has the same sequence as SLS25 but with an additional 5'-TTATT tail as the control for non-paired bases. SLS31 is formed by the interaction of two different strands 31(a) and 31(b). Besides this oligonucleotide duplex, when in the SLS form, contains two binding sites for antibiotic Distamycin A, that can result in stabilization of the true SLS rather than its "kissing hairpin" isomer. Our current experimental data (chemical and S1 probing, electrophoretic mobility, CD spectra) can be explained by the SLS form of polynucleotide chain.
References
1. Gorgoshhidze, M. Z. et al. (1992) Molecular
Biology 26, 832-838.
2. Ulyanov, N. B., Bishop, K. D., Ivanov, V. I. and James, T. L. (1994),
NAR 22, 4242-4249.
3. Minyat, E. E., Khomyakova, E. B., Petrova, M. V., Zdobnov, E. M., and
Ivanov, V. I. (1995) JBSD 13, 523-527.
Supported by Fogarty Intern. Res. Collaboration and Russian Fund for Basic Researches.
Role of Electrostatic Factors
in Interaction Between Minor Groove Binders and DNA
A. L. Zhuze, S. L. Grokhovsky, R. V. Brussov, A. M.
Nikitin, D. V. Salmanova, A. L. Mikheikin, S. A. Streltsov, T. A. Leinsoo,
V. O. Chekhov, G. V. Gursky, R. H. Shafer*, and A. S. Zasedatelev
Engelhardt Institute of Molecular Biology RAS,
117984 Moscow, Russia
*Department of Pharmaceutical Chemistry,
University of California at San Francisco,
San Francisco, CA 94143, USA
I. Interaction between DNA and an isosteric analog of antibiotic distamycin A (Dst), which contains three furancarboxamide fragments in the central part of the molecule (F-Dst), has been studied by circular dichroism (CD) and flow linear dichroism (LD) (1). The LD spectral data for Dst and F-Dst bound to DNA were analyzed using the oscillator forces and orientations of the moments of electronic transitions obtained by quantum-mechanical calculations. Three types of complex between F-Dst and DNA were observed, with ligand:DNA base pair ratios of 0.2, 0.8, and 3. The complex with the 0.2 ratio is analogous to the well-known monomeric type of Dst-DNA complex, but is significantly less stable against ionic strength and exhibits no CD; in contrast to the Dst one, it is detected only by flow LD.
The difference between F-Dst and Dst binding to DNA points to the significant role of the partial charges at the ligand atoms facing the DNA minor groove in the ligand-DNA complex.
II. A new class of extended DNA-binding compounds containing N,4-disubstituted phthalimide fragments and carrying positive charges at both ends of the molecule was synthesized and characterized by physicochemical methods (2). All compounds fluoresced at 460 nm upon excitation at 340 nm. Their interaction with natural DNA and synthetic polydeoxyribonucleotides was examined by UV, CD, and spectrofluorometry The ligand comprising phthalimide and dipyrrolcarboxamide fragments linked by a flexible spacer was shown to occupy five base pairs in the DNA minor groove. Formation of this complex was accompanied by an increase in the CD amplitude at 320 nm and enhanced fluorescence. Ligands based on only phthalimide fragments did not bind in the minor groove but formed a weakly fluorescing complex of external binding type, characterized by one ligand molecule per two DNA base pairs saturating ratio.
References
1. Mikheikin, A.L. et al (1997) Mol. Biol.(Russia)
31, in press.
2. Salmanova, D.V. et al (1995) Mol. Biol.(Russia) 29, 848-861.
Supported by Fogarty International Research Collaboration
Award, NIH (grant 5R03 TW00145), and the RFBR (grant 95-03-09502), State
Program "Chemical and Biological Synthesis of Novel Drugs" (grant
04.01.02).
Chromosome Structure and Gene Regulation
K. J. Polach, R. U. Protacio, P. T. Lowary and J. Widom
Department of Biochemistry, Molecular Biology,
and Cell Biology,
and Department of Chemistry,
Northwestern University,
2153 Sheridan Road,
Evanston, IL 60208-3500
This talk will summarize our recent studies on chromosome
structure and gene regulation. Key results include: (1) We derive an equation
that relates the free energy of histone-DNA interactions in nucleosome reconstitution
to the probability of nucleosome positioning. This equation emphasizes that
nucleosome positioning is statistical, not "precise". We measure
the extent to which bulk genomic DNA sequences contribute to their own nucleosome
packaging and positioning. (2) We carried out a SELEX experiment from a
large pool of chemically synthetic random DNA sequences to identify DNA
those sequences having the highest affinity for histone octamer. The resulting
sequences reveal a wealth of nonrandom features. Some of these are new,
while others were seen in earlier studies of nucleosomal DNA sequences and
in our recent Fourier transform analysis of genomic DNA. (3) We have developed
a system for synchronous, real-time physical studies of nucleosome transcription.
Our initial studies provide direct views of the elongation reactions and
test the lexosome model of transcription. (4) We have proposed a "site
exposure" model for a mechanism whereby gene regulatory proteins may
gain access to their DNA target sites. In this model, nucleosomes are dynamic
structures, transiently exposing their DNA, and regulatory proteins gain
access to their target sites in the exposed state. Experimental studies
reveal that nucleosomes do possess such a property, and provide quantitative
measurements of equilibrium constants for site exposure. The results explain
and clarify existing studies of regulatory protein binding and make many
additional specific predictions. The model also accounts for the ability
of polymerases to elongate through nucleosomal templates.
Triple Helix Formation by (GA)-containing Oligonucleotides: An Asymmetric Sequence Effect
Paola B. Arimondo1, Francesca Basolo2, Jian-Sheng Sun1,
Jean-Claude Maurizot3, Thérèse Garestier1, Claude Hélène1
1Laboratoire de Biophysique,
Muséum National d'Histoire Naturelle,
INSERM U201, CNRS URA 481,
43 rue Cuvier, 75231 Paris Cedex 05, France
2Universitat de les Illes Balears,
Dpto. de Biologia i Ciències de la Salut,
Palma de Mallorca, Spain.
3Centre de Biophysique Moléculaire,
Université d'Orléans,
rue Charles Sadron, 45071 Orléans Cedex 2, France.
The capacity of (GA)-containing oligonucleotides to form pyrimidine·purine*purine motif triple helices has been investigated. These oligonucleotides were strongly self-associated into intermolecular complexes, which were destabilised as the temperature increased (from 4°C to 37°C). To minimise the competition of the self-association of the oligonucelotides with the process of triplex formation, the experiments were carried out at 37°C and at low strand concentration (20nM) of triple helix-forming oligonucleotides (TFOs). Two systems containing a 15-bp oligopurine·oligopyrimidine sequence with identical base composition have been investigated. The first system contains a tract of (AGG)4 on the target purine strand, whereas the sequences are reversed in the second system (thus containing a tract of (GGA)4 on the target purine strand). A set of (GA)-containing TFOs were designed. They share a common 5'-end and differ at the 3'-end in the first system, and vice versa in the second one.
It was found that:
The stability of two triple-helices with identical length but reverse strand orientation may be very different (up to a factor of 6).
In the first system, a 13-mer (GGA) repeat containing TFO exhibits 3 and 5 folds higher affinity for the 15-bp target sequence than the 14-mer and the 15-mer TFOs, respectively; while the increasing of the length of the triplex forming oligonucleotide provides, in the second system, a higher affinity for the target.
The nature of the base triplets involved at both ends of
the oligonucelotide may have different effects on the stability of triple
helix. This asymmetry of sequence effect in the (GA)-motif triplex formation
is discussed here in terms of the binding strength of the first base triplets
at the 3' end, which seems to be a determining factor for the stability.
Interactions of Sanguinarine with Polymorphic Structures of Deoxyribonucleic Acid
Suman Das, Anjana Sen, Arghya Ray, Gopinatha Suresh
Kumar and Motilal Maiti
Biophysical Chemistry Laboratory,
Indian Institute of Chemical Biology,
Calcutta 700 032, India
Sanguinarine, a benzophenanthridine alkaloid is endowed with wide ranging biological activities. The anti-microbial, anti-plaque, anti-inflammatory, anti-tumoral potency and anti-tubilin effects of this alkaloid and its derivatives are especially noteworthy. Our laboratory has been interested in elucidating the structure-activity relationship and had showed for the first time that sanguinarine binds to DNA by the mechanism of intercalation (1). Further extensive spectrophotometric, spectrofluorimetric, spectropolarimetric, viscometric and thermodynamic studies on its interaction with a series of natural and synthetic DNAs showed that it exhibits considerable specificity to GC rich DNA especially alternating GC polymer (2-5). Since alternating GC polymer can undergo B-Z transition in response to local enviornment changes, we have studied the binding aspects of sanguinarine to right and left handed forms in order to gain more insight ar nature of its recognition to these confomational variants.
The interaction of sanguinarine to B- and Z- forms of poly (dG-dC).poly (dG-dC) has been studied by spectrophotometric, spectrofluorimetric, circular dichroism, UV melting profiles and thermodynamics. The binding to B- form is characterized by typical hypochromic and bathochromic effects in the absorption spectra, quenching of the steady state fluorescence intensity, decrease in fluorescence quantum yield, increase in fluorescence polarization anisotropy value, increase of thermal transition temperature and perturbation in circular dichroic spectrum. Scatchard analysis indicates that sanguinarine binds to right handed B-form in a non-linear, non- cooperative manner. The binding parameters determined from absorption titration data by Scatchard analysis, employing the excluded site model indicate a strong binding of sanguinarine to B- form polymers. Thermodynamic parameters (/\Go, /\Ho, /\So) obtained by van't Hoff analysis of data show that the process of binding to B-form polymer is exothermic and enthalpy driven as characterized by a favourable negative enthalpy change (/\Ho). The binding to Z- DNA showed that the alkaloid converts the Z- form of poly (dG-dC). poly (dG-dC) to a form almost similar to the B- form, while it inhibits both the rate and extent of B-Z transition as evidenced from absorption and circular dichroic spectral characteristics. These studies reveal for the first time that sanguinarine binds strongly to B-form polymer while it does not bind to the Z-form.
This work is partially supported by a grant (SP/SO/D21-91) from the Department of Science and Technology, Government of India.
References
1. M. Maiti, R. Nandi and K. Chaudhuri, FEBS Letters
142, 280-284 (1982).
2. R. Nandi, K. Chaudhuri and M. Maiti, Photochem. Photobiol. 42,
497-503 (1985).
3. M. Maiti, and R. Nandi, J. Biomol. Struct. Dyn. 5, 159-175 (1987).
4. A. Sen and M. Maiti, Biochem. Pharmacol. 48, 2097-2102 (1994).
5. A. Sen, A. Ray and M. Maiti, Biophys. Chem. 59, 155-170 (1996).
Structural and Dynamics Studies of Bacterial Regulatory Proteins
John Cavanagh
NMR Structural Biology Facility,
Wadsworth Center,
New York State Department of Health,
Albany, NY 12201
In order to survive, all cells must sense changes in their environment and respond appropriately. Such responses result in a change of the cell morphology as gene products are expressed to allow the cell to adapt to the new circumstances. The proteins involved in ensuring that the cell accommodates the change are components of complex signal transduction networks and all are vital to the cell's survival. Though the environmental alterations may be for the good, such as an increase in nutrient supplies, the most recent focus has been on those changes which cause stress and threaten the cell. In these cases, signal transduction networks are established which help to protect the cell and allow it to survive under the adversity. In bacterial systems, this can result in the induction of virulence factors by the direct regulation of the expression of pathogens or by the regulation of adaptive mechanisms to protect against pathogens.
With this in mind, the our research is focused towards understanding the mechanistic and molecular recognition features involved in bacterial response regulatory processes, using high-resolution NMR spectroscopy. The structure, dynamics and modes of interaction of a series of proteins involved in the passage of Bacillus subtilis from it's vegetative state, through it's transition state, to it's self-protective stationary phase are being studied. These proteins are expressed when the bacterium encounters stressful conditions due to nutrient deprivation and high cell density. This system is a paradigm for signal transduction systems required for virulence, environmental sensing, cell-cycle control and cell-cell communication in bacteria.
In terms of the health relatedness of this research, it
should be noted that proteins homologous to those being studied here, have
been implicated in controlling the virulence pathways many species including
Bordatella pertussis , the causative agent of whooping cough and Staphylococcus
aureus, a producer of hemolysins and toxins including the toxic shock syndrome
toxin. Others include macrophage infection by Salmonella typhimurium, alginate
production in cystic fibrosis patients by Pseudomonas aeruginosa and vaginal
adhesion factors by Neisseria gonorrhea. The information gained from this
work concerning mechanism and recognition should prove extremely valuable
in the control or inhibition bacterial pathogenesis.
Alzheimer Disease Hyperphosphorylated TAU Aggregates Hydrophobically
George C. Ruben(1), Thomas L. Ciardelli(2), Inge Grundke-Iqbal(3),
and Khalid Iqbal(3)
(1)Dept. Biological Sciences,
Dartmouth College,
Hanover, NH, 03755, USA,
(2)Dept. of Pharmacology and Toxicology,
Dartmouth Medical School,
Hanover, NH, 03756
(3)New York State Institute for Basic Research in Developmental Disabilities,
Staten Island, NY, 10314, USA
The chemical interaction that condenses the hyperphosphorylated protein tau in Alzheimer's disease (AD P-tau) into neurofibrillary tangles and cripples synaptic transmission remains unknown. Only beta-sheet, positive ion salt bridges between phosphates, and hydrophobic association can create tangles of just AD P-tau. We have correlated transmission electron microscope (TEM) images of tau aggregation with different percentages of beta-sheet in aqueous suspensions of tau while using buffers that block dipositive or tripositive ionic bridges between intermolecular phosphates. Circular dichroism (CD) studies were performed at different temperatures from 5deg. to 85deg.C using AD P-tau, AD P-tau dephosphorylated with hydrofluoric acid (HF AD P-tau) or alkaline phosphatase (AP AD P-tau), recombinant human tau with 3-repeats and two amino terminal inserts (R-39), and using bovine tau (B tau) isolated without heat or acid treatment. Secondary structure was estimated from CD spectra at 5deg. C using the Lincomb algorithm. Each preparation except one demonstrated an inverse temperature transition, Ti , in the CD at 197 nm. No correlation was found between beta-sheet content and aggregation, leaving only hydrophobic interaction as the remaining possibility. Thirteen of 21 possible phophorylation sites in AD P-tau lie adjacent to positive residues in tau's primary structure. Occupation of 5-9 phosphate sites on AD P-tau appears sufficient to reduce or neutralize tau's basic character. AD P-tau's hydrophobic character is indicated by its low inverse temperature transition,Ti. The Ti for AD P-tau was 24.5deg. C or 28deg. C whereas for B tau with three phosphates it was 32deg. C, for unphosphorylated tau R-39 it was 38deg.C and for dephosphorylated HF AD P-tau it was 37.5deg. C. The hydrophobic protein elastin and its analogs coalesce and precipitate at their Ti of 24deg.-29deg. C well below body temperature. We hypothesize that AD P-tau causes tangle accumulation by this mechanism.
DNA-backbone Modifications That Affect Duplex Stability
Daniel Barsky(1), Michael E. Colvin(1), Gerald Zon(2),
Sergei M. Gryaznov(2)
(1)Sandia Nat. Labs,
Livermore, CA 94551-0969
(2)Lynx Therapeutics, Inc., 3
832 Bay Center Place,
Hayward, California 94545
In the pursuit of DNA modifications that could yield viable
antisense compounds, a number of surprising behaviors have arisen. Recent
studies on uniformly modified oligonucleotides containing 3'-NHP(O)(O$^-$)O-5'
internucleoside linkages (3' amidate) and alternatively modified oligonucleotides
containing 3'-O(O$^-$)(O)PNH-5' internucleoside linkages (5' amidate) have
shown that 3' amidates duplexes, formed with DNA or RNA complementary strands,
are more stable in water than those of the corresponding phosphodiesters,
yet 5' amidates do not form duplexes at all [S. M. Gryaznov {\it et al.},
Proc.\ Nat.\ Acad.\ Sci.\, 92(5798--5802), 1995]. We demonstrate that these
differences arise from differential solvation of the sugar-phosphate backbones.
By molecular dynamics calculations on models of 10-mer single-stranded DNA
and double-stranded DNA-RNA molecules, both with and without the phosphoramidate
backbone modifications, we show that the single-stranded 3' amidate and
5' amidate backbones are equally well solvated, but the 5' amidate backbone
is not adequately solvated in an A-form duplex. These results are supported
by quantum chemical free energy of solvation calculations which show that
the 3' amidate backbone is favored relative to the 5' amidate backbone.
Dynamical Structure of B-DNA Oligonucleotides Containing Phased A-tracts in Salt Water Solution
M. A. Young and D. L. Beveridge
Molecular Biophysics Program,
Wesleyan University,
Middletown, CT 06459 USA
Sequences of DNA containing stretches of Adenines (A-tracts)
positioned in phase with the 10.5 base pair helical repeat of B-form DNA
have been known for some time to exhibit a variety of unique structural
features. One consequence of their unique properties is that properly positioned
phased A-tract sequences have been shown to be capable of enhancing transcription
activation of certain genes which are regulated by DN
A-binding
proteins which bend DNA. Thus, determining the structural features of phased
A-tract DNA may help to understand a mechanism for structurally attenuated
gene regulation, most possibly involving DNA bending. Sequence-dependent
bending of the A-tract sequence motif has been extensively studied and a
number of models have been proposed, but there is still not an unequivocal
model which can account for the range of experimental data on the structure
of A-tracts at atomic level detail. This study presents results of multi-nanosecond
(ns) length molecular dynamics (MD) trajectories obtained for the DNA oligonucleotide
duplex of sequence d(ATAGGCAAAAAATAGGCAAAAATGG)2 and others in water with
various concentrations of ionic species (K+, Na+, Mg2+, and Cl-). The MD
was carried out by computer simulations based on the AMBER4.1 force field,
which has been independently demonstrated to support an accurate model of
B form DNA in solution when used together with a particle mesh Ewald summation
(PME) treatment of long range electrostatics. The MD results show that under
the appropriate conditions: A) the model exhibits spontaneous axis bending
in a concerted direction with an average magnitude of ~16.5° per A-tract
(~33° overall). This result compares qualitatively with the axis bending
anticipated for A-tracts phased by a full helix turn, and bending per turn
of approximately 17-21° inferred from cyclization experiments. B) The
model exhibits a progressive 5' -> 3' narrowing of the minor groove,
a feature inferred from extensive results from DNA footprinting studies
by Tullius and coworkers of phased A-tract sequences. Thus the AMBER 4.1
model of phased A-tracts sequences of DNA gives an account at the molecular
level of the salient features observed for the sequence dependent helix
morphology of sequences with A-tracts phased by a full helical turn.
Molecular Design for DNA Recognition: An Approach Toward Gene-Specific Transcription Inhibition in vivo by Synthetic Ligands
Peter B. Dervan
Division of Chemistry and Chemical Engineering,
California Institute of Technology,
Pasadena, CA 91125
Small molecules that specifically bind at subnanomolar concentrations to any predetermined DNA sequence in the human genome would be useful tools in biology and potentially in human medicine. Pairing rules have been developed to control rationally the DNA sequence specificity of minor-groove-binding polyamides containing N-methylimidazole and N-methylpyrrole amino acids.1,2 An imidazole ring paired antiparallel with a pyrrole recognizes a G·C base pair, whereas a pyrrole-imidazole combination targets a C·G base pair. A pyrrole/pyrrole pair is degenerate for A·T or T·A base pairs. Using a simple molecular shape and a two-letter aromatic amino-acid code, eight-ring pyrrole-imidazole polyamides achieve affinities and specificities comparable to DNA-binding proteins and, in addition, have the potential to be general for any desired DNA sequence.3 This non-biological approach to DNA recognition could provide an underpinning for the design of cell-permeable molecules for the control of gene-specific regulation in vivo.
References
1. W. S. Wade, M. Mrksich and P. B. Dervan, J. Am. Chem.
Soc., 114, 8783 (1992).
2. M. Mrksich et al., Proc. Natl. Acad. Sci. USA, 89, 7586
(1992).
3. J. W. Trauger, E. E. Baird and P. B. Dervan, Nature, 382, 559
(1996).
Back to Table of Contents: Abstracts
Back to Table of Contents: Tenth Conversation