Malgorzata Boczkowska*, Barbara Nawrot and Wojciech J. Stec
Polish Academy of Sciences,
Centre of Molecular and Macromolecular Studies,
Department of Bioorganic Chemistry,
Sienkiewicza 112,
90-363 Lodz, Poland
*Author to whom correspondence should be addressed. Phone: (+48-42)-6816970;
Fax:(+48-42)-6815483; E-mail: mboczkow@bio.cbmm.lodz.pl
Oligonucleotide analogues such as methanephosphonates or phosphoramidates, possessing high affinity towards double stranded DNA (dsDNA) are good candidates for the antigene strategy (1). Recently we have synthesized DNA oligomers with a novel P-chiral methanephosphonamidate [3 '-NH-P(O)(CH3)O-5 '] internucleotide linkage, and found their stereodependent affinity toward dsDNA (2). Here we present data on the relation between triplex stability and the number and chirality of introduced backbone modifications.

Diastereomerically pure dithymidine methanephosphonamidates (X) were used as building blocks to prepare four chimeric stereodefined 20-mers of two sequences T6X4T6 and TX9T, both of [RP] or [SP] absolute configuration. Both modified oligomers of [RP] configuration have better hybridization properties towards hairpin oligomer d(A21C4T21) compared to the unmodified T20 and [SP] counterparts (Table I). The triplex-hairpin transition strongly depends on NaCl concentration indicating the crucial role of sodium cations in stabilization of the triplex structure (3). However, even at high salt concentration we did not observe any formation of triple helice from the oligomers TX9T [SP] and d(A21C4T21). In the case of T20 or TX9T [RP] oligomers as third strands, the replacement of ammonium chloride for sodium chloride results in enhancement of the triplex stability, but no binding was observed in the case of TX9T [SP] oligomer (Table I, data in parentheses).
Diagnostic decrease in the CD signals at 220 nm (4) showed the presence of triplex structures formed by d(A21C4T21) with T20 or TX9T [RP], but not TX9T [SP], as the third strands. It was confirmed by the presence of corresponding slowly migrating bands on native PAGE.
Table I
Melting temperatures [Tm, °C] of triplex-hairpin
and ssDNA transition#.

#Melting profiles were recorded in 10 mM TRIS/HCl pH 7.0, 10 mM MgCl2, and appriopriate amount of salt; *NH4Cl was used instead of NaCl; n.t. no transition
Evaluating duplexes formed of modified oligomers with complementary DNA and RNA strands we found that their thermal stabilty is much lower than that of duplexes composed of unmodified strands, and decrease in melting temperature of the duplexes caused by each methanephosphonamidate linkage of [SP] configuration is two times bigger than that casued by the [RP] counterpart. In conclusion, low binding affinity of chimeric oligo(deoxyribo-nucleoside methanephosphonamidate)s of [RP] configuration to ssDNA and RNA strands and their improved affinity toward dsDNA makes them promising agents in antigene therapy.
References and Footnotes
1. Giovannangeli C. and Helene C., Antisense and Nucleic
Acids Drug Dev. 1997, 7, 413.
2. Nawrot B., Boczkowska M., Wojcik M., Sochacki M., Kazmierski S. and Stec
W.J., Nucleic Acids Res. 1998, 26, 2650.
3. Rougee M., Faucon B., Mergny J.L., Barcelo F., Giovannangeli C., Garestier
T., and Helene C., Biochemistry 1992, 31, 9269.
4. Johnson K.H., Gray D.M., Sutherland J.C., Nucleic Acids Res., 1991,
19, 2275.
Malgorzata Boczkowska, Piotr Guga* and Wojciech J. Stec
Polish Academy of Sciences,
Centre of Molecular and Macromolecular Studies,
Department of Bioorganic Chemistry,
Sienkiewicza 112,
90-363 Lodz, Poland
*Author to whom correspondence should be addressed. Phone:(++48-42)-6816970;
Fax: (++48-42)-6815483; E-mail: pguga@bio.cbmm.lodz.pl
The conformational changes leading to Z-DNA were for the first time observed in 1972 in the CD spectra of poly[d(GC)] recorded in the presence of molar concentrations of sodium chloride (1). Phosphorothioate analogues of DNA are useful models for investigating the B-Z transition because of their structural similarity to natural DNA (2). However, these analogues if synthesized by non stereocontrolled method exist as a mixture of 2n diastereomers, where n is a number of phosphorothioate internucleotide bonds. Standard chemical methods for synthesis of at least partially P-stereodefined oligomers usually employ a dimer block approach and provide "chimeric" oligomers with stereodefined phosphorothioate linkages (of RP or SP absolute configuration) only in alternate positions. Studies on "chimeric" oligomers revealed the important consequences of phosphorothioate substitution on the B-Z transition (2).
Using oxathiaphospholane method (3) fully modified diastereomerically pure [All-RP]- and [All-SP]-oligomers [PS]-d(CG)4 and [PS]-d(GC)4 were synthesized in our laboratory. CD spectroscopy revealed that NaCl induces the B-Z transition of [All-RP-PS]-d(CG)4 to the extent of ca. 50% at 5 M NaCl (Figure 1, dashed line), and does not convert [All-RP-PS]-d(GC)4 octamer (Figure 1, dotted line). The [All-SP-PS]-d(GC)4 oligomer at NaCl concentration higher than 2 M adopts a "C-DNA"-like conformation (Figure 2, dashed line).
The [All-SP-PS]-d(CG)4 oligomer at NaCl concentration higher than 0.01 M adopts a unique conformation (Figure 2, dotted line) and cannot be driven into the Z-form. For the latter case, numeric analysis of the CD spectrum indicates the presence of additional negative band centered at 282 nm.

Interestingly, the duplex formed by [All-SP-PS]-d(CG)4 is thermodynamically more stable than that by [All-SP-PS]-d(GC)4 (57E vs 54EC) and is also the most stable one among the phosphorothioate analogues.
References and Footnotes
1. Pohl, F.M., and Jovin, T.M. (1972) J. Mol. Biol.
67, 375-396.
2. Cosstick, R., and Eckstein, F. (1985) Biochemistry 24, 3630-3638.
3. Stec, W.J., Karwowski, B., Boczkowska, M., Guga, P., Koziolkiewicz, M.,
Sochacki, M., Wieczorek, M., and Blaszczyk, J. (1998) J. Am. Chem. Soc.
120, 7156-7167.
Michael Shubsda, Mark McPike, Jerry Goodisman and James Dabrowiak
Department of Chemistry,
Syracuse University,
Syracuse NY 13244-4100
The packaging region of HIV, which spans ~ 140 nt near the 5 ' end of
the genome, is believed to include four stem-loop structures. One of the
structures, SL1, contains the dimer initiation site (DIS), which initiates
base pairing between two copies of the genome to form a dimer. Using non-denaturing
PAGE and radiolabeling we measured the dimerization equilibrium constant
and studied the dimerization kinetics for 41-mer, 27-mer and 19-mer RNAs
that contain the DIS of HIV-1 MAL. The monomer-dimer ratio was measured
as a function of RNA concentration, ionic strength, equilibration temperature
and gel running temperature. The values of K for the three RNAs at I
= 101 mM were, 0.181, 0.50 and 40 x 106 M-1
respectively. The increase in dimerization free energy with length may be
associated with entropy changes for the rod-like molecules. Binding of the
nucleocapsid protein, NCp7, to SL3 (another stem-loop structure from the
packaging region) has also been studied using non-denaturing PAGE. Analysis
of solutions containing equal concentrations of radiolabeled RNA and protein
from 510 to 0.55 µM revealed the presence of three species, the free
RNA and two protein-RNA complexes. Fitting the autoradiographic intensity
to a model showed that the complex present at intermediate concentrations
has an RNA to protein stoichiometry of 2:1 while the slowest-running species,
present at highest concentrations, contains 8 RNAs and 4 proteins, i.e.,
it is a tetramer of the 2:1 complex. The results of this study are interpreted
in terms of previous work on nucleocapsid binding to RNA and the role of
NCp7 in condensation of RNA in the virion of the HIV virus.
V. I. Danilov1, J. L. Alderfer2, V. I. Poltev3 and O. N.
Slyusarchuk1
1Institute of Molecular Biology and Genetics,
The National Academy of Sciences of Ukraine,
150 Zabolotny St., Kiev-143 Ukraine
2Roswell Park Cancer Institute,
Buffalo, N.Y. 14263 USA
3Institute of Theoretical and Experimental Biophysics,
The Russian Academy of Sciences,
Pushchino,
Moscow Region 142292, Russia
An extensive Monte Carlo simulation of hydration of various conformations
of the dinucleoside monophosphates (DNP), containing thymine, uracil and
its 5-halogen derivatives has been performed. An anti-anti conformation
is the most energetically stable one for each of the DNPs. In the majority
of cases the energy preference is determined by water-water interaction.
For other dimers conformational energy is the most important factor, or
both the factors are of nearly equal importance. The introduction of the
methyl group into the 5-position of uracil ring most noticeably influences
the conformational energy and leads to the decrease of its stabilizing contribution
to the total interaction energy. The introduction of halogen atoms increases
the relative content of anti-syn and syn-anti conformations
of DNPs as compared to the parent ones due to the formation of an energetically
more favorable water structure around these conformations. A correlation
is observed between the Monte Carlo results for the halogenated DNPs and
their experimental photoproduct distribution. The data obtained demonstrates
a sequence dependence in the photochemistry of the halogenated dinucleoside
monophosphates.
Mensur Dlakic1 and Tom K. Kerppola1,2
1Howard Hughes Medical Institute,
2Department of Biological Chemistry,
University of Michigan Medical School,
Ann Arbor, MI 48109-0650
Maf proteins belong to the basic-region leucine zipper (bZIP) transcription
factor family. The hallmarks of this family are a leucine-zipper dimerization
domain which mediates protein-protein interactions through a hydrophobic
interface, and a region rich in basic residues responsible for DNA binding.
Besides these two domains, Mafs have a distinctive DNA binding motif comprising
30 residues on the N-terminal side of the basic region. Maf dimers bind
to the DNA sequence TGCtgactcaGCA. They show less stringent requirement
for the core AP-1 site (in lowercase) than Fos and Jun family proteins.
Instead, the protein has higher preference for sequences flanking the AP-1
site (capitalized). This binding specificity, unique within the AP-1 proteins
family, led to the hypothesis that Maf family proteins contain an ancillary
DNA binding domain that is responsible for the recognition of sequences
flanking the AP-1 site. Using mutational analysis and chemical footprinting,
we provide evidence for direct DNA recognition by the ancillary DNA binding
region of Maf. The data are interpreted in the context of a molecular model
for the Maf-DNA complex.
Mensur Dlakic1, Wendy M. Dlakic2 and Rodney E. Harrington3
1Howard Hughes Medical Institute,
University of Michigan Medical Center,
Ann Arbor, MI 48109-0650
2Department of Human Genetics,
University of Michigan,
Ann Arbor, MI 48109-0618
3Department of Microbiology,
Arizona State University,
Tempe, AZ 85287
The wealth of structural detail produced by first crystallographic studies
of B-DNA established initial patterns of sequence-dependent variations in
DNA. The number of solved DNA structures dramatically increased in the past
decade, thus offering a solid basis for statistical analyses aimed at extracting
general principles of DNA structure. Of necessity, however, the studies
were confined to dinucleotide step parameters, because the number of available
tetranucleotides in the crystallographic database is still too small for
a complete analysis. To explore the effects of sequence context, we analyzed
B-DNA molecules from the Nucleic Acid Database for degenerate tetranucleotides
of the type r/yNNr/y (r/y stands for purine or pyrimidine, while NN represents
one of the ten unique dinucleotides). The nucleic acid parameters were determined
using a global and local calculation schemes. Confirming previous studies,
we observe the largest variability for YR dinucleotides in different sequence
contexts. The prediction quality of degenerate tetranucleotide models was
evaluated on several DNA sequences using a purpose-written software.
Marcia O Fenley1,2, Alexander H. Boschitsch2 and Wilma K. Olson1
1Continuum Dynamics, Inc.,
P. O. Box 3073,
Princeton, NJ 08543
2Department of Chemistry,
Rutgers, The State University of New Jersey,
Wright and Rieman Laboratories,
610 Taylor Road,
Piscataway, NJ 08854-8087
We have developed a fast boundary element method for solving the linear
Poisson-Boltzmann equation for arbitrarily shaped molecules in ionic solution.
All previous fast boundary element formulations of molecular electrostatic
problems have been restricted to the Poisson equation (zero salt concentration)
and thus cannot account for ionic strength effects. The computational complexity
of the method (both CPU and storage) here described scales as O(NlogN) where
N is the number of surface elements representing the dielectric boundary
at the molecular surface. This is achieved by using a spherical modified
Bessel function-based multipole expansion for computing screened Coulombic
interactions between the surface elements. In order to assess the computational
performance and accuracy of the fast boundary element Poisson-Boltzmann
solver we examine a spherical geometry containing interior charges for which
analytical solutions are available. Furthermore, we compute the reaction
field energy of small organic molecules and protein molecules using the
fast boundary element Poisson-Boltzmann solver. Our results are in good
agreement with analytical results as well as with similar results from finite-difference
calculations.
Marcia O. Fenley1,2, Gerald S. Manning1 and Wilma K. Olson1
1Department of Chemistry,
Rutgers, The State University of New Jersey,
Wright and Rieman Laboratories,
610 Taylor Road,
Piscataway, NJ 08854-8087
2Continuum Dynamics, Inc.,
P. O. Box 3073,
Princeton, NJ 08543
We compute the excess number of counterions associated with branched
DNA, and the ionic stabilities of these structures as a function of chain
length and both sodium and magnesium salt concentration, using numerical
counterion condensation theory. The structures are modeled as three or more
finite lines of phosphate charges radiating from the junction center. The
geometries of large three- and four-way DNA junctions (with > 50 base
pairs per arm) in solutions containing low to moderate NaCl accumulate a
substantial number of excess sodium ions (>20) but not more than 15 magnesium
counterions. The excess number of counterions surrounding the branched DNA
structures remains invariant or increases with chain length, tending to
reach a plateau value. Open configurations, such as the planar Y-shaped
three-way junction (with three 120° inter-arm angles) and the 90°
cross-shaped four-way junction, are ionically more stable than compact geometries,
such as pyramidal three-way junctions and X-shaped four-way junctions, over
the entire range of salt concentration considered (10-5-10-1 M NaCl or MgCl2). The ionic stabilities
of the compact forms increase with increasing salt concentration and become
comparable to those of the extended geometries at high salt (especially
when magnesium is the supporting salt). We also treat four-way DNA junctions
more realistically in terms of its three-dimensional structure (given by
the location of the phosphate groups) and present the results.
Xiaolian Gao1, Jie Ji1,
Adonis Stassinopoulos2 and Irving H. Goldberg2
1Department of Chemistry,
University of Houston,
4800 Calhoun St.,
Houston, TX 77204-5641
2Department of Biological Chemistry and MolecularPharmacology,
Harvard Medical School,
Boston, MA 02115
Neocarzinostatin chromophore (NCS-chrom) is the first member in a family of highly potent enediyne antitumor antibiotics that bind to specific DNA sequences and cause single and/or double strand lesions. The mechanisms of DNA damage of NCS-chrom have been studied extensively. These studies have led to the finding that the drug acts on both duplex and single stranded DNA sequences with high specificity. The site of action is determined by the reaction conditions under which the drug is activated.
High resolution structure elucidation of the NCS-chrom (in a post-activated
form) and oligonucleotide complexes of both binding forms has revealed unexpected
pictures. Despite the post-activated drugs share common chemical structure
components, such as the carbohydrate ring, in the two binding modes (to
a duplex and to a single stranded DNA) the interactions between the drug
and DNA are distinctly different. The duplex binding mode involves the drug
intercalation from the minor groove; the single stranded DNA binding mode
locks the DNA into a bulge structure and the drug is wedged into the bulge
cavity from the major groove. This presentation will present the analysis
of latter complex and the free DNA using high resolution NMR and the comparison
of the two complexes. The insights will be provided into the principles
of molecular recognition of host-ligand molecular complexes.
Eric M. LeProust1*, Christopher E. Pearson2,3*, Richard R. Sinden2
and Xiaolian Gao1
1Department of Chemistry,
University of Houston,
4800 Calhoun St.,
Houston, TX 77204-5641
2Center for Genome Research,
Institute of Biosciences and Technology,
Texas A&M University,
Texas Medical Center,
2121 West Holcombe,
Houston, TX 77030-3303
3Present address:
Department of Genetics,
Hospital for Sick Children,
555 University Avenue,
Toronto, Ontario, Canada, M5G 1X8
*These two authors contributed equally to this work.
The most common hereditary ataxia, Fridreich's ataxia (FRDA), affects neuromuscular systems of human organs, such as heart, kidney, arms and legs. The onset and progress of FRDA are associated with the genetic instability or expansion of the GAA/CTT trinucleotide repeats located within chromosome 9q13 X25 intron and adjacent to the frataxin gene. Conventional wisdom led to the belief that triplexes of RRY and YRY types (R = purine and Y = pyrimidine residues) may contribute to their genetic instability of these homo-purine or homo-pyrimidine sequences.
We have used NMR, UV, gel electrophoresis and chemical and enzymatic probing methods to study GAA and CTT repeats under a range of pH and ionic conditions. We demonstrate that the complementary GAA and CTT strands interact to form not only an antiparallel duplex, but also a parallel duplex. At lower pH only the 2(CTT)n/1(GAA)n (YRY type) triplex not the 2(GAA)n/1(CTT)n (RRY type) triplex was observed. Single strands of GAA and CTT repeats were also examined.
These results reveal the structural diversity and the structure dynamic nature of the GAA and CTT repeats and provide insights into the structural preferences of these sequences. These features of the GAA and CTT repeats are unique to other hereditary neuromuscular and neurodegenerative disease related triplet repeats, such as CCG/CGG and CAG/CTG. Further efforts are directed to elucidate these unusual structures and the effect of repeat length on their formation. The understanding of these aspects are of fundamental importance to the establishment of the molecular basis of the mechanism of hereditary FRDA.
Xueyong Yang, Laëtitia Sonigo, Hua Zhang, and Yogesh Sanghvi
and Xiaolian Gao
Department of Chemistry,
University of Houston
ISIS Pharmaceuticals, Inc.
Antisense oligonucleotides for gene regulation through complementary binding to RNA targets have attracted intense research efforts. The success of this approach relies on stable duplex or multiplex formation of the oligonucleotides with target RNA. These structures may induce RNA strand cleavage by RNase H at the binding site or cause blockage of specific gene regulation sites. The mechanisms of these processes may be attributed to a number of factors, such as structures and properties of single stranded antisense and RNA sequences and their hybridization properties. To further the progress in this field, it is of fundamental importance to understand the molecular basis of antisense actions in vivo and in vitro.
A set of backbone modified antisense oligonucleotides have been studied in great detail in this laboratory, using high resolution NMR and UV spectroscopic methods and enzymatic digestion assays. The backbone modifications studied include formacetal(FMA)1, 3 '-thioformacetal linkage (TFMA)2, and 3'-methylenemethylhydroxyamino(MMI) . These backbone linkers were incorporated into dodecamer sequences, (d[CGCGTTxTTGCGC) or d[CGCGTxTTxTGCGC]), which were subsequently examined in single stranded states and in hybridized forms. In some cases, 2'-OMe groups were incorporated and their structural effect were examined.
These studies have provided a wealth of information concerning the functions of backbone modifications in self-stabilization and in hybridization of antisense sequences. These results will be presented to illustrate the progress made towards the understanding of the principles for designing a new generation of effective antisense oligonucleotides.
James M. Aramini1, Anwer Mujeeb2 and Markus W. Germann1*
1Department of Microbiology and Immunology,
Kimmel Cancer Institute,
Thomas Jefferson University,
Philadelphia, PA 19107
2Department of Pharmaceutical Chemistry,
University of California,
San Francisco, CA 94143.
*Autrhor to whom correspondence should be addressed. Phone: (215) 503 4581;
Fax: (215) 923 2117; E-mail: mwg@lac.jci.tju.edu.
Synthetic oligonucleotides (ODNs) containing a combination of alpha- and beta-anomeric stretches separated by polarity reversals possess a number of traits that make them potentially viable candidates for use in the area of antisense therapy. In an effort to optimize the antisense properties of such alpha-/beta-ODNs our laboratory is investigating their thermodynamic, enzymatic, and structural attributes.
Here we present the three-dimensional solution structure and dynamic properties of a model self-complementary DNA decamer duplex, [d(GCGAAT-3´-3´-alphaT-5´-5´-CGC)2], alphaT, containing an a-anomeric nucleotide per strand flanked by 3´-3´ and 5´-5´ phosphodiester bonds. The average solution structure of alphaT was elucidated by restrained molecular dynamics (rMD) in vacuo (AMBER 4.1) using quantitative interproton distance restraints, calculated from 2D NOE data via the complete relaxation matrix approach RANDMARDI, and deoxyribose torsion angle restraints obtained from complete pseudorotation analysis of DQF-COSY data. The structure exhibits very low R x factors ( ~3.7 to 4.2%) and low average restraint violations, and is highly homologous to that for the unmodified control duplex (see figure), featuring several traits diagnostic of an overall right-handed B-DNA motif. The orientation of the alpha-thymidine in each strand is reversed, facilitating proper base pairing and stacking in the helix. These nucleotides also feature S-type sugar puckers, albeit with an increased pseudorotation angle (C3´-exo) compared to their beta-anomeric counterparts.
However, both the NOE and J-coupling constant data provide evidence for significant conformational averaging of the deoxyribose ring in the nucleotide following the 5´-5´ linkage in each strand (C8/C18). This prompted us to investigate the conformational dynamics within this molecule using the restrained molecular dynamics with time-averaged restraints (MDtar) approach (AMBER 4.1), in which the quantitative interproton distance and deoxyribose torsion angle restraints are enforced over a period of time (i.e., 10 ps) rather than constantly as in the rMD calculations. MDtar runs (> 150 ps) performed on the final average alphaT structure in a solvent box with counterions and explicit water molecules show a sharp decrease in overall constraint energy and average distance violations as well as significant N<->S puckering dynamics for the C8 and C18 deoxyribose rings. Furthermore, the dynamic behavior of two of the backbone torsion angles (g and e) of the alpha-nucleotides are consistent with homonuclear (J 4´5´´) and heteronuclear (J 3´-P) coupling information. Finally, the backbone torsion angles involved in the 5´-5´ linkages are distributed over a wide range indicative of appreciable conformational heterogeneity, whereas the 3´-3´ linkages are relatively static.

Stereoview of the superimposed final structures of the alphaT (blue)
and unmodified control (grey) duplexes (RMSD 1.1 Å excluding the a-anomeric
and terminal residues). For both strands of the alphaT duplex, the alpha-anomeric
thymidine and subsequent cytidine are shown in red and green, respectively.
S. L. Grokhovsky1,3 , A.N. Surovaya1, G. Burckhardt2, V. F.
Pismensky1, S.A. Rodin1,
B.K. Chernov1, Ch. Zimmer2
and G.V. Gursky1
1Engelhardt Institute of Molecular Biology,
Russian Academy of Sciences,
Moscow 117984, Russia
2Institute of Molecular Biology,
Friedrich Schiller University,
Jena, Germany
3University of Oslo,
Center for Medical Studies,
Oslo, Norway
We studied the interaction of cis-diammine Pt(II)-bridged bis-netropsin (< Nt-Pt(NH3)2-Nt >), cis-diammine Pt(II)-bridged bis-distamycin (< Dst-Pt(NH3)2-Dst >) and oligomethylene-bridged bis-netropsin (< Nt-(CH2)5-Nt >) (Figure 1) with synthetic DNA fragments containing pseudosymmetrical AT-rich nucleotide sequences and compared it with the interaction of the parent compounds netropsin and distamycin A.

Figure 1
To facilitate comparison of the binding of sequence-specific ligands
to different AT-rich sites we have used cloned synthetic DNA fragments as
substrates for footprinting studies. For fragments containing multiple blocks
of (A/T)4 and (T/A)4 separated
by zero, one, two and three GC-base pairs, DNase I footprinting and CD spectroscopy
studies reveal that 5 '-TTTTAAAA-3 ' is the strongest affinity binding site
for cis-diammine Pt(II)-bridged bis-netropsin and bis-distamycin.
They practically do not interact with DNA regions in which two blocks of
four to five AT-base pairs are separated by CC, CG, GC, GG and GGG steps
and bind less strongly to a DNA region containing the sequence 5 '-AAAATTTT-3
'. In contrast, < Nt-(CH2)5-Nt > binds to DNA oligomers with sequences
5 '-CCTTTTAAAACC-3 ' and 5 '-CCAAAATTTTCC-3 ' with nearly the same affinity.
Netropsin and distamycin A exhibit far less sequence discrimination. Thermodynamic
parameters were determined for binding of < Nt-Pt(NH3)2-Nt > and
< Nt-(CH2)5-Nt
> in the extended conformation and hairpin form to DNA dodecamers
with different nucleotide sequences. Supported by Deutche Volkswagen Stiftung
(grant AZ I/70490) and Russian Foundation for Basic Research (grant 97-04-49047).
Nikolai B. Ulyanov1, William R. Bauer2* and Thomas L. James1
1Dept. of Pharmaceutical Chemistry,
UC San Francisco,
San Francisco, CA 94143-0446
2Dept. of Molecular Genetics and Microbiology,
Health Sciences Center,
SUNY at Stony Brook,
Stony Brook, NY 11794-5222
*Author to whom correspondence should be addressed. Phone: (516) 632-8811;
Fax: (516) 632-9797; E-mail: wbauer@ms.cc.sunysb.edu
The DNA of vaccinia virus is a large (180 kbp) linear duplex with cross-linked termini, such that a single strand circle forms upon denaturation. The terminal 10 kbp are inverted repeats, and the ultimate 106 nucleotides at each end form incompletely base paired hairpins; they are involved in the formation of replicative intermediates of vaccinia virus (1). The terminal hairpins are extremely AT-rich (96% AT) and contain an asymmetric internal loop and a number of single base bulges. Here we describe studies on a number of synthetic oligonucleotides containing a fragment of the "left" hairpin of vaccinia virus:
5 '-T-A-A-T-T-A-T-A-A
| | | | | | | | |
A-T-T-A A-T A-T-T-5 '
C G
Oligonucleotides studied include an imperfect DNA duplex GTAATTATAAG:CTTAGTACATTAC (Tm ca. 15°C at 100 mM K+ and 1mM DNA), and two monomolecular constructs with an "extraordinarily stable" DNA hairpin loop GAA (2): 29mer CCTAATTATAACGAAGTTAGTACATTAGG (Tm 45°C at 100 mM K+), and control 27mer lacking extra G and C residues CCTAATTATAACGAAGTTATAATTAGG (Tm 65°C). Based on homonuclear proton NMR data, extra C residue is extra-helical in the salt range of 10 to 100 mM K+, while G appears to be stacked in and to have multiple conformations. A high-resolution solution structure for the 27mer and preliminary results for the 29mer will be presented.
References and Footnotes
1. Baroudy, B. M., Venkatesan, S. & Moss, B., Cold
Spring Harbor Symp., Quant. Biol. 47, 723-729, 1983.
2. Hirao, I., Kawai, G., Yoshizawa, S., Nishimura, Y., Ishido, Y., Watanabe,
K. & Miura, K., Nucl. Acids Res. 22, 576-582, 1994.
Adrian Goerler, Nikolai B. Ulyanov and Thomas L. James
Dept. of Pharmaceutical Chemistry,
UC San Francisco,
San Francisco, CA 94143-0446
When distinct conformers contribute to NMR signal, traditional refinement of solution structures may lead to various averaging artefacts (1). We propose a new method of refinement of structural ensembles of nucleic acids in solution, which is based on combination of three existing approaches.
1. We are using the DNAminiCarlo program (2) which performs conformational calculations (energy minimization or Metropolis Monte Carlo simulation) in the internal coordinate space (generalized helical parameters of nucleic acids).
2. Rather than a single molecule, an ensemble of conformers is refined simultaneously (3-5). Force field energy is calculated separately for each conformer, while the harmonic penalty term is applied to the ensemble-averaged quantities corresponding to the observed NMR data.
3. Populations of conformers are calculated at each step of the simulation with the PDQPRO program (6), which uses a quadratic programming algorithm for fitting the ensemble-averaged quantities to the observed data.
For the penalty term, we are using proton dipole-dipole relaxation rates derived from the nuclear Overhauser effect data. However, any observed NMR parameters, which can be ensemble averaged in a linear fashion, can be used as well (such as scalar coupling constants). The results of application of this method to a number of simulated systems will be presented.
References and Footnotes
1. Jardetsky, O., Biochim. Biophys. Acta 621, 227-232,
1980.
2. Zhurkin, V. B., Ulyanov, N. B., Gorin, A. A. & Jernigan, R. L,. Proc.
Natl. Acad. Sci. USA 88, 7046-7050, 1991.
3. Bonvin, A. M. & Brunger, A. T,. J. Mol. Biol. 250, 80-93,
1995.
4. Kemmink, J. & Scheek, R. M., J. Biomolec. NMR 6, 33-40, 1995.
5. Fennen, J., Torda, A. E. & van Gunsteren, W. F., Biomolec. NMR
6, 163-170, 1995.
6. Ulyanov, N. B., Schmitz, U., Kumar, A. & James, T. L., Biophys.
J. 68, 13-24, 1995.
R.L. Jernigan
Molecular Structure Section,
Laboratory of Experimental and Computational Biology,
National Cancer Institute,
National Institutes of Health,
Bethesda, MD 20892-5677
It has not been possible to infer directly from their structures what are their functional motions, with the exception of local motions such as those involved in enzyme reactions. We have developed an extremely simple model for describing protein motions. The model corresponds to a network of springs, where an identical spring is placed between the sequential residues as well as between each close non-bonded residue pair. The ranges of displacements about the native protein structure are treated in a normal mode-like analysis, which is much simpler than molecular dynamics. It becomes possible to separate the motions into modes with characteristic rates, the slowest being the collective motions, and the fastest indicating individual residues that are the most highly constrained. Calculations show excellent agreement with a wide variety of data: temperature factors from crystallography, hydrogen exchange data, and the extent of conservation of residues. For Reverse Transcriptase, by following the correlations of motions between domains, it becomes possible to visualize the RNA step-wise processing motion. Typically the most constrained residues correspond to those in active sites, hinges and protein cores which are usually highly conserved. Because of its simplicity the method can be applied to large proteins and assemblages of proteins and should be useful for guiding protein design.
References and Footnotes
1. I. Bahar, B. Erman, R.L. Jernigan, A. R. Atilgan, and
D.G. Covell: Collective Motions in HIV-1 Reverse Transcriptase: Examination
of Flexibility and Enzyme Function. J. Mol. Biol. 1999 285, 1023-1037.
2. Demirel, M.C., Atilgan, A.R., Jernigan, R.L., Erman, B. and Bahar, I.:
Identification of kinetically hot residues in proteins. Protein Sci.
1998 7, 2522-2532.
3. Bahar, I. and Jernigan, R.L.: Vibrational dynamics of transfer RNAs:
Comparison of the free and synthetase-bound forms. J. Mol. Biol. 1998
281: 871-884.
Hye-Kyung Kim1, Katsumi Morimatsu2, Eimer Tuite1, Bengt Norden1 and Masayuki
Takahashi2*
1Department of Physical Chemistry,
Chalmers University of Technology,
S-412 96 Gothenburg, Sweden
2UMR 216,
Institut Curie & CNRS,
F-91405 Orsay, France
*Author to whom correspondence should be addressed. Phone: +33(1) 69863013;
Fax: +33(1) 69863011; E-Mail: Masa.Takahashi@iris2.curie.u-psud.fr
The molecular mechanism of homologous recombination catalyzed by RecA in E. coli has been extensively studied. RecA protein promotes pairing of two homologous DNA molecules, branch migration and strand exchange in the homologous recombination. In eukaryotes, Rad51 protein, a eukaryotic homolog of RecA protein, plays a crucial role in homologous recombination. Electron microscopy and neutron scattering studies have shown that Rad51 protein forms, like RecA protein, a filamentous complex with DNA for the reaction, indicating a similar reaction mechanism. HsRad51 protein promotes ATP-dependent homologous pairing and strand transfer reaction in vitro(1). We have purified human Rad51 (HsRad51) protein to investigate the mechanism of homologous recombination in higher eukaryotes. Fluorescence measurements of fluorescein-labeled oligonucleotides and a fluorescent poly(dA) analog show that HsRad51 dissociates from ssDNA upon addition of ATP as previously observed for Xenopus XRad51 protein (2). The reaction was complete within 20 minutes. We examine the mechanism and the role of this dissociation in the strand exchange reaction.
Acknowledgments
The research is supported by grants from STINT (Sweden) and EU Biomed Program.
References and Footnotes
1. Baumann P., Benson F. E., and West C., Cell 87,
757-766 (1996)
2. Maeshima, K., Morimatsu, K. and Horii, T., Genes Cells 1, 1057-1068
(1996)
Hong Zhang and Thomas R. Krugh
Department of Chemistry,
University of Rochester,
Rochester, NY 14627
Six-nucleotide hairpin loops occur frequently in ribosomal RNA. Optical melting studies show that r(GCGUUAAUUCGCA), r(GCGUUAAGUCGCA), r(GCGGAAAUACGCA), and r(GCGGUAAAACGCA) each fold into hairpins containing a six nucleotide loop. Thermodynamic parameters of hairpin formation in 0.1 M NaCl for these hairpins are reported, where we note that the free energy of loop formation is dependent upon loop sequence. Two-dimensional NMR approaches are being used to determine the structure of the r(GCGUUAAUUCGCA) hairpin.
Ryszard Michalczyk*1, Charles C. Orji2 and L. A. "Pete" Silks1
1Bioscience and Biotechnology Group,
Chemical Science and Technology Division,
CST-4, Los Alamos National Laboratory,
Los Alamos, NM 87545
2CEO, Paradigm Organics, Inc.,
Partners Building II, Suite 3900,
820 University Park Drive, Raleigh, NC 27606
*Author to whom correspondence should be addressed. Phone: 505-667-7918;
Fax: 505-665-5052; E-mail: rmichalczyk@lanl.gov
Heteronuclear multidimensional NMR spectroscopy is an attractive and versatile tool for the study of the structure and dynamics of nucleic acids in solution. The progress in synthesis of uniformly 13C and 15N labeled RNA led to the development of novel NMR methods and their application to structural studies of RNA. Due to limited availability of labeled deoxynucleosides similar studies of DNA have lagged behind. Despite recent advances in the enzymatic synthesis of DNA oligomers, chemical synthesis of the nucleoside precursors remains the method of choice for preparation of synthetic oligonucleotides.
Our ongoing efforts to develop methods for DNA labeling have resulted in a number of 15N and 2H singly and multiply labeled DNAs. One of our major goals has been to develop a common synthetic pathway to both deoxyadenosine (dA) and deoxyguanosine (dG). Previously reported syntheses of dA and dG use 4,5,6-triaminopyrimidine and 2,4,5,6-tetraaminopyrimidine as crucial intermediates. Due to their C2 symmetry, these intermediates cannot be used for selective labeling at C4 and C6, or N9, and the 6-amino nitrogen. To overcome this limitation we have devised a synthetic strategy in which 2,4,5-triamino-6-chloro pyrimidine serves as a pivotal intermediate. Annulation of this intermediate using triethylorthoformate in ethanol gives 2-amino-6-chloropurine, which is subsequently converted to either deoxyguanosine (via 2,6-diaminopurine) or deoxyadenosine (via 6-chloropurine). The newly developed synthetic route allows for straightforward and efficient incorporation of isotopes at any desired position of dA or dG using easily accessible and inexpensive common precursors.
We have applied this new synthetic scheme to the synthesis of [2,4,8-13C3; 1,3,7,9,amino-15N5]-2 ' -deoxyguanosine and [2,4,8-13C3; 1,3,7,9,amino-15N5]-2 '-deoxyadenosine on a multigram scale. The labeled deoxynucleosides were incorporated into a DNA 16-mer containing the binding site for human papillomavirus E2 protein. Assignments of proton resonances using hetero-TOCSY and HMQC NMR experiments to demonstrate the usefulness of the labeling pattern will be reported. The simplification of spectral assignment procedure and potential for heteronuclear editing shows great promise in application to larger and more complex DNA molecules.
E. Palecek1, M. Brazdova1, H. Cernocka1, V. Brazda1 and B. Vojtesek2
1Institute of Biophysics,
Academy of Sciences of the Czech Republic,
612 65 Brno, Czech Republic
2Masaryk Memorial Cancer Institute,
656 53 Brno, Czech Republic
We showed that wild type human p53 protein was preferentially bound to supercoiled (sc) DNA in vitro both in the presence and absence of the p53 consensus sequence (CON) (1). This binding produced a ladder of retarded bands on the agarose gel. Using immunoblotting with the antibody DO-1, we showed that the bands on the blot corresponded to the ethidium-stained DNA bands suggesting that each band of the ladder contained a DNA-p53 complex. The intensity and the number of these bands were decreased by physiological concentrations of zinc ions (2). At higher zinc concentrations binding of p53 to scDNA was completely inhibited. The binding of additional zinc ions to p53 appeared much weaker than the binding of the intrinsic zinc ion in the DNA binding site of the core domain. In contrast to previously published data (3) suggesting that 100 micromolar zinc ions did not influence p53 binding to CON in a DNA oligonucleotide, we showed that zinc efficiently inhibited binding of p53 to CON in DNA fragments at concentrations by one order of magnitude lower. We also showed that relatively low concentrations of dithiothreitol but not of 2-mercaptoethanol decreased the concentration of free zinc ions preventing thus their inhibitory effect on binding of p53 to DNA. Nickel and cobalt ions inhibited binding of p53 to scDNA and to consensus sequence in linear DNA fragments less efficiently than zinc; cobalt ions were least efficient requiring >100 mM Co2+ for full inhibition of the p53 binding. Modulation of binding of p53 to DNA by physiological concentrations of zinc might represent a new path of regulation of p53 activity in vivo.
References and Footnotes
1. Palecek, E., Vlk, D., Stankova, V., Brazda, V., Vojtesek,
B., Hupp, T.R., Schaper, A. and Jovin, T.M., Oncogene 15 (1997) 2201-2209.
2. Palecek E., Brazdova M., Cernocká H., Vlk D., Brazda V. and Vojtesek
B.,Oncogene, in press
3. Coffer, A.I. and Knowles, P.P., Biochim. Biophys. Acta 1209 (1994)
279-285
M. Tomschik1, F. Jelen1,
L. Havran1, P. E. Nielsen2,
M. Fojta1 and E. Palecek1
1Institute of Biophysics,
Academy of Sciences of the Czech Republic,
612 65 Brno, Czech Republic
2Center for Biomolecular Recognition,
IMBG, Department of Biochemistry B,
The Panum Institute,
Blegdamsvej 3c, DK 2200 Copenhagen, Denmark
In the last decade a large variety of DNA and RNA-like molecule has been synthesized with the aim to use these analogues in genetic therapy as antisense and antigene agents (1,2). One of these molecules is peptide nucleic acid (PNA) which has properties required for such agent in terms of biostability and highly selective binding to complementary RNA or DNA. PNA is a DNA mimic that binds strongly and specifically to complementary DNA and RNA oligomers, but in contrast to DNA its backbone does not carry any electric charge. From a chemical point of view PNA molecule consists of a pseudopeptide backbone composed of N-(2-aminoethyl)glycine to which the bases are attached through methylene carbonyl linkers to the glycine nitrogens (3). Many papers were published in the field of chemistry, molecular biology and genetic engineering (rewieved in (4)), while only a few papers refer to interfacial properties of this unique molecule (5).
Adsorption of PNA and DNA oligomers at a hanging mercury drop electrode (HMDE) was studied by means of a.c. impedance measurements. It was found that the adsorption behavior of PNA differed greatly from DNA with a negatively charged backbone (6). Cyclic and square-wave voltammetry and constant current chronopotentiometry were used to study reduction and oxidation signals of single stranded PNA and DNA decamers and pentadecamers at mercury and carbon electrodes. It was shown that the signals produced by the DNA oligomers at the HMDE, i.e. the cathodic peak CA (due to reduction of cytosine and adenine) and the anodic peak G (due to guanine) corresponded to those observed earlier with single stranded chromosomal and plasmid DNAs. We found that PNA yielded similar signals as DNA, however, at more negative potentials. The above mentioned DNA and PNA peaks were studied in dependence on accumulation time, oligomer concentration and on some parameters of the electrochemical measurements. Detection limit of PNA was below 5 ng/ml at accumulation time (tA) 5 min and at tA=1 min peak G of PNA gave a linear calibration up to about 500 ng/ml. Oxidation of PNA and DNA at a pyrolytic graphite electrode yielded two well-separated oxidation peaks of guanine and adenine residues. Oxidation peaks of PNA were lower compared to DNA ones, i.e. opposite to what was observed by the voltammetric techniques at HMDE, where anodic peaks of PNA were always higher than those of DNA with the corresponding base sequences. It was concluded that the different redox behavior of PNA compared to DNA is primarily due to different adsorption properties of these two compounds.
References and Footnotes
1. B. Hyrup, M. Egholm, O. Buchardt and P.E. Nielsen, Bioorg.
& Med. Chem. Lett., 6 (1996) 1083.
2. P.E. Nielsen, M. Egholm, R.H. Berg and O. Buchardt, Science, 254 (1991)
1497.
3. P.E. Nielsen, Bioconjugate Chem., 2 (1991) 1.
4. B. Hyrup and P.E. Nielsen, Bioorg. Biomed. Chem., 4 (1996) 5.
5. J. Wang, G. Rivas, X. Cai, M. Chicharro, N. Dontha, D. Luo, E. Palecek
and P.E. Nielsen, Electroanalysis, 9 (1997) 120.
6. J. Wang, E.Palecek, P. Nielsen,G. Rivas, X.Cai, H. Shiraishi, H. Dontha,
D. Luo and P. Farias, J. Am. Chem. Soc. 118 (1996) 7667
7. M. Fojta, V. Vetterl, M. Tomschik, F. Jelen, P. Nielsen, J. Wang and
E. Palecek, Biophys. J., 72 (1997) 2285.
M. Fojta, T. Kubicarova, L. Havran and E. Palecek
Academy of Sciences of the Czech Republic,
Královopolská 135,
61265 Brno, Czech Republic
Electroactivity of nucleic acids was discovered about 40 years ago (1,2). In 60th's and 70th's polarographic measurements provided an early evidence of DNA pre-melting and polymorphy of DNA double helix (3). In the past decade a new experimental strategy based on nucleic acid-modified electrodes eliminated the main disadvantage of conventional electrochemical techniques, i.e. the requirement for rather high DNA sample volumes (reviewed in 4). With present techniques microliter volumes of DNA can be analyzed making thus possible analyses of samples which preparation is labourious and/or expensive, including chemically modified oligonucleotides such as peptide nucleic acids (5) or DNA topoisomers (6). Development of DNA electrochemical biosensors represents another trend which has gained importance in recent years (reviewed in 7).
We found (6) that adsorption/desorption behaviour of supercoiled (sc) DNA at native and highly negative superhelix densities, and relaxed covalently closed circular DNA differed from each other. A detailed study of topoisomer distributions ranging from superhelix density of zero to -0.11 revealed two supercoiling-dependent transitions, at about -0.04 (transition TI, related probably to changes in the DNA tertiary and/or secondary global structure) and -0.07 (transition TII, related to opening of DNA double helix at elevated negative superhelicity). The latter transition was detected also using a single strand selective chemical probe osmium tetroxide, 2,2'-bipyridine.
The electrochemical and adsorption behavior of scDNA at mercury electrodes strongly differs from that of DNAs containing free ends of chains (open circular, oc, or linear DNAs) (8,9). The latter produce alternating current voltammetric peak 3 that has been attributed to DNA molecules adsorbed at mercury surface via bases. No such peak is produced by sc (covalently closed circular) DNA (8). In addition, a restricted reducibility of bases in scDNA (as compared to those in DNA containing strand breaks) at the mercury electrode was observed (9). On the other hand, the behavior of sc and linear DNA at a carbon electrode did not significantly differ (10).
The sensitivity of voltammetric and chronopotentiometric signals of DNA measured at mercury electrodes to the presence of DNA strand breaks was utilized in studies of cleavage of scDNA at mercury electrode surface (8,9,11-13). It has been shown that surface-confined scDNA can be nicked by chemical nucleases, e.g. hydroxyl radicals generated in Fenton reactions mediated by transition metal ions in the presence of hydrogen peroxide and a reducing agent. Based on this principle, a biosensor for DNA damaging substances was proposed (8,11). Cleavage of immobilized scDNA at the mercury electrode mediated by transition metals in absence of reducing agents can be modulated by electrode potential (12). Besides low molecular mass DNA damaging agents, supercoiled DNA adsorbed at electrically charged mercury surface can be attacked and cleaved by deoxyribonuclease I (13). Kinetics of this reaction is strongly potential-dependent, suggesting an influence of the electrical field close to the electrode surface on the DNase I-DNA interaction.
References and Foonotes
1. Palecek, E. (1958) Naturwiss. 45 , 186-187.
2. Palecek, E. (1960) Nature 188 , 656-657.
3. Palecek, E. (1976) in: Progress in Nucleic Acid Research and Molecular
Biology, Vol. 18, pp. 151-213 (Cohn, W.E., Ed.) Academic Press, New
York.
4. Palecek, E. (1996) Electroanalysis 8, 7.
5. Fojta, M., Vetterl, V., Tomschik, M., Jelen, F., Nielsen, P., Wang, J.
and Palecek, E. (1997) Biophys. J. 72, 2285-2293.
6. Fojta, M., Bowater, R.P., Stankova, V., Havran, L., Lilley, D.M.J. and
Palecek, E. (1998) Biochemistry 37, 4853-62.
7. Palecek, E., Fojta, M., Tomschik, M. and Wang, J. (1998) Biosens.
Bioelectron. 16, 621-628.
8. Fojta, M. and Palecek, E. (1997) Anal. Chim. Acta 342, 1-12.
9. Fojta, M., Havran, L. and Palecek, E. (1997) Electroanalysis 9,
1033-1034.
10. Cai, X., Rivas, G., Farias, P.A.M., Shiraishi, H., Wang, J., Fojta,
M. and Palecek, E. (1996) Bioelectrochem. Bioenerg. 40, 41-47.
11. Fojta, M., Stankova, V., Palecek, E., Mitas, J. and Koscielniak, P.
(1998) Talanta 46, 155-161.
12. Fojta, M., Kubicarova, T. and Palecek, E. (1999) in preparation.
13. Fojta, M., Kubicarova, T. and Palecek, E. (1999) Electroanalysis,
submitted.
Vladimir N. Potaman1, Elena A. Oussatcheva1, Richard R. Sinden1, Luda
S. Shlyakhtenko2,3 and Yuri L. Lyubchenko2,4
1Institute of Biosciences and Technology,
Texas A&M University,
2121 West Holcombe Blvd.,
Houston, TX 77030-3303
2Departments of Microbiology
4Biology,
Arizona State University,
Tempe, AZ 85287-2701
3BioForce Laboratory, Inc.,
Ames, IA 50010-8277
Repeated sequences are associated with a high frequency of mutagenic events. In addition, the development and progression of several diseases has been traced to an expansion of the number of trinucleotide repeats. Slipped misalignment can occur in repeated sequences during DNA replication leading to the formation of heteroduplex structures. Polyacrylamide gel migration and atomic force microscopy (AFM) were used to study heteroduplexes based on a 301 bp Pvu II-Pvu II fragment of plasmid pUC8 where the hairpin-forming sequences were inserted in different restriction sites in the polylinker.
The formation of the three-way junction results in bending of a heteroduplex
DNA fragment that migrates in a polyacrylamide gel slower than expected
for its size. Moreover, heteroduplex isomers in which hairpins form in either
one or another strand (as identified by sequence analysis) separate in a
gel into a faster and slower migrating bands. For a given pair of gel-purified
heteroduplex isomers, determination of the end-to-end distances and the
angles between long arms from AFM data showed that their geometries are
different. This difference can be explained by either the influence of the
sequence at the three-way junction or the presence of an additional sequence-specific
bend that can be in phase or out of phase with the hairpin-induced bend.
Gel mobility assay performed with the fragments in which specific regions
were deleted supported the second explanation. The hypothetical bend is
very likely localized in the GGCC sequence that is 10 bp away from the polylinker.
In line with this suggestion, different strand compositions are observed
for heteroduplexes with the three-way junctions separated by a non-integer
number of helical turns and, therefore, bending DNA in the opposite directions.
Interestingly, the curved geometry of the GGCC sequence is not revealed
in linear fragments that migrate close to expected size in 5% and 10% polyacrylamide
gel. However, adding the three-way junctions that, according to AFM, are
non-planar creates complex three-dimensional shapes of the molecule so that
the minor changes in geometry induced by specific motifs may lead to changes
in the overall geometry sufficient for their detection by gel retardation
assay. Thus, the three-way junctions may be used for detecting relatively
minor local sequence-specific structural details.
Vladimir N. Potaman
Institute of Biosciences and Technology,
Texas A&M University,
2121 West Holcombe Blvd.,
Houston, TX 77030-3303
Folds in DNA templates, such as hairpins and multi-stranded structures, often serve as pause and arrest sites for DNA polymerases in vivo and in vitro. In vivo, long DNA sequences prone to intramolecular folding tend to be deleted, and folding in the short sequences promotes mutagenic events. In order to increase fidelity of DNA polymerization for analytical purposes, we tried to prevent the in vitro folding of single-stranded DNA into hairpin and triple-stranded forms.
In certain cases linear amplification with one primer results in the synthesis of polynucleotides whose lengths imply longer than expected template DNA. We present the evidence that the unexpectedly long polynucleotides are synthesized due to an intramolecular priming from the stem/loop structures formed at short 3 '-terminal inverted repeats (IR) in the nascent strands. Hairpins 6 or more base pairs long are strong priming structures for an intramolecularly templated synthesis and 4 bp hairpins are able to initiate as much as 10% of snap-back synthesis. This effect is significant for the terminal IR-containing DNA fragments generated by either a restriction digest or PCR amplification. As IR 6 bp and longer occur once in several hundred to several thousand base pairs of genomic DNA, we tested the ways to reduce the intramolecular priming. Increasing reaction temperature is only partially hairpin-destabilizing, and addition of betaine that reduces the melting temperature of GC pair to that of AT pair is required to eliminate the effect of terminal IR on DNA polymerization. In vivo implication of these results is that the high frequency of the hairpin initiated DNA synthesis lends biochemical support to genetic models of mutagenesis based on a possibility of strand misalignment at palindromic sequences.
One of the most difficult obstacles for DNA polymerization on a single-stranded
template is a triple-stranded structure (triplex) formed in mirror repeated
homopurineChomopyrimidine sequences. Hybridization of a nascent strand and
a folded purine template in the wake of DNA polymerase produces a hairpin-stabilizing
triplex that the enzyme cannot unwind and stalls. Once formed, this triplex
barrier is very stable at neutral pH and even at elevated temperatures of
PCR reaction. The formation of a triplex barrier for DNA synthesis can be
inhibited by an oligonucleotide that hybridizes across the center of the
mirror repeated template to prevent it from folding. The progressing DNA
polymerase then displaces this oligonucleotide. It is likely that the formation
of strong triplex barriers observed during in vitro polymerization
is prevented in vivo by the single-strand-binding proteins, in particular,
by the homopyrimidine or homopurine strand-specific proteins whose functions
have not been identified yet.
Manashi Chatterjee* and Malvinder P. Singh
Department of Chemistry,
University of Saskatchewan,
Saskatoon, Saskatchewan,
Canada S7N 5C9
*Author to whom correspondence should be addressed. Fax: (306) 966-4730;
E-mail <chatterjee@skyfox.usask.ca>
Molecular recognition of the DNA minor groove by design at targeted fragment sequences has attracted much research interest in the past decade. In particular, molecular building blocks (modules) such as pyrrolecarboxamide (from distamycin/netropsin), imidazolecarboxamide (cf lexitropsins), benzimidazole (from Hoechst 33258) and most recently, hydroxypyrrolecarboxamide, have been employed in the assembly of a variety of useful DNA minor groove binding agents. The design strategy of coupling two distamycin or related analogs using flexible and rigid tethers has also been moderately successful in targeting longer DNA sequences by harnessing the selectivity of monomeric subunits for 4-5 base pairs. Reviewing a number of structural and molecular interaction studies on DNA complexed with model minor groove binding agents, it is evident that the observed DNA sequence selective binding and direct information readout arises predominantly from the formation of an extended array of hydrogen bonds between the donor/acceptor groups on DNA bases and the ligand modules.
In seeking improved versions of covalently linked dimeric DNA binding agents, we hypothesized that the linker element itself possessing appropriately spaced hydrogen-bond donor groups (amide NH) could conceivably provide additional anchoring points for a stronger contact within the binding site for dimeric distamycin and analogous compounds.
Guided by analysis of the geometric and spatial relationships of the amide/NH groups in minor groove binders, we focused on aliphatic nylon-like amide assemblies that mimic the structural features of distamycin itself. A series of eight novel nylon-like oligoamides have been developed and used as linkers in the modular assembly of 28 dimeric polyamides including a subset of 10 different covalently linked netropsin- and distamycin-like dimers. Synthesis of this group of agents and data on characterizing their DNA binding profiles are presented. As determined from molecular modeling data for isohelical interactions with DNA for the nylonic amide-linked dimers, the new linkers offer an additional control towards achieving a balanced stretchability/rigidity due to fewer degrees of rotational freedom (e.g., fumaric spacer) and the variability of the central diamine components of the linkers.
This research program supported by the University of Saskatchewan, HSURC-Saskatchewan, NSERC-Canada and CFI-Canada.
Malvinder P. Singh* and Wei Lu
Department of Chemistry,
University of Saskatchewan,
Saskatoon, Saskatchewan S7N 5C9
Canada
*Author to whom correspondence should be addressed. Fax: (306) 966-4730;
E-mail: <singh@sask.usask.ca>
The bis-benzimidazole class of fluorescent dyes, including Hoechst 33258, share a number of structural and functional features with the oligopyrrolecarboxamide frameworks of DNA minor groove binding agents, distamycin and netropsin. Particularly noteworthy is the periodic spacing of hydrogen bond donor groups that is presumably a primary determinant in the molecular recognition of specific DNA sub-sequences by these structurally diverse agents.
While there has been a steady progress made in the design of DNA minor groove binding agents by making use of carboxamides derived from N-methylpyrrole and N-methylimidazole, the modular assembly approach to Hoechst 33258 analogs has not been exploited fully. In general, the oligobenzimidazole frameworks have been difficult to synthesize due to solubility problems. From the structural features of minor groove binding agents in general, and an apparent requirement for regular spacing of hydrogen boned donor groups, we have designed and developed efficient synthesis of a novel combination of pyrrole and benzimidazole rings that mimics the arrangement of repeating units of distamycin and Hoechst 33258.
In this study, a series of new compounds have been developed by a modular assembly of pyrrolecarboxamide and the novel pyrrolyl-benzimidazole fluorophore. Results from selected types of DNA binding assays, using Tm, fluorescence and NMR titration measurements, are indicative of a fairly high selectivity for DNA sub-sequences rich in A·T base pair content. Molecular modeling of selected complexes of the hybrid agents with oligonucleotides are also consistent with the observed preference of A·T-rich DNA. A simultaneous binding of two molecules of an analog within the DNA minor groove is strikingly similar to earlier models derived for 2:1 distamycin:DNA complexes.
This research is supported by the University of Saskatchewan, HSURC-Saskatchewan,
NSERC-Canada and CFI-Canada.
M. Krasteva1, H. Wieser1
and J.H. van de Sande2
1Department of Chemistry,
Faculty of Science,
University of Calgary,
Calgary, AB, T2N 1N4
2Department of Medical Biochemistry,
Faculty of Medicine,
University of Calgary,
Calgary, AB, T2N 1N4.
Vibrational Circular Dichroism (VCD) spectroscopy monitors the difference in response of optically active molecules to left and right circularly polarized infrared radiation. The method has proven successful for small molecules as well as for macromolecules, including DNA. The particular helical arrangement in the nucleic acid molecules gives rise to distinct features in VCD spectra. The technique has greater potential for structural studies than electronic CD, which is extensively used, since VCD arises from specific molecular vibrations and hence provides more detailed information about the actual molecular structure.
Peptide nucleic acid (PNA) is a synthetic DNA analogue in which the entire sugar-phosphate backbone of DNA has been substituted with a peptide-like chain. Despite such radical structural alteration, PNA binds to DNA and RNA in double helical arrangement. Two complementary PNA strands form a double helix with distinct structure, considered as a new form of Watson-Crick double helix, termed P-form.
VCD spectra of selected oligonucleotide PNA and DNA complexes will presented
and correlations between structure of the complexes and observed spectral
features will be highlighted.
V. Andrushchenko1,3, H.Wieser1,
J.H. van de Sande2, S. Kornilova3 and
Yu. Blagoi3
1 Department of Chemistry,
University of Calgary,
Calgary, AB, T2N 1N4 Canada
2 Department of Medical Biochemistry,
Faculty of Medicine,
University of Calgary,
Calgary, AB, T2N 1N4 Canada
3 B.I.Verkin Institute for Low Temperature Physics
and Engineering,
National Academy of Sciences of Ukraine,
Kharkov 310164, Ukraine
The relatively new spectroscopic technique, known as IR (Vibrational) Circular Dichroism (VCD) spectroscopy has been applied recently to investigations of nucleic acids (T. Keiderling, M. Diem, V. Maharaj and H.Wieser). It has been shown that this method has a number of advantages compared to IR or related electronic CD spectroscopy. In the present study VCD spectroscopy was applied to investigating Mn2+ ion interaction with synthetic oligonucleotides, namely d(GC)20 and d(ATGCATGCAT). In this study VCD spectroscopy has proved to be a powerful and sensitive tool for monitoring DNA structural and conformational changes. Due to the fact that VCD signal arises from the helical structure of DNA and the high sensitivity of VCD, even relatively slight changes of the DNA geometry, not seen by ECD or IR techniques, are revealed in VCD. It has been particularly useful to study the B-Z transition of d(GC)20 due to high sensitivity of VCD to the change of the handedness of the DNA helix from the right-handed in B-form to the left-handed in Z-form. Based on the experimental results, cooperativity and midpoint of the B-Z transition, depending on an incubation time of d(GC)20 with Mn2+ ions, have been estimated using the modified Hill equation. For both oligonucleotide samples, macromolecular compactization and aggregation were revealed. Based on the experimental results, binding constants and cooperativity of Mn2+ ion binding to d(ATGCATGCAT) were estimated. Theoretical computations of the oligonucleotide geometry and both IR and VCD spectra using ab initio quantum mechanical calculations are currently in progress.